| Variant ID: vg0825175613 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25175613 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGCAATAGATGAAGCCACATTCCGAGAATCCAAAATATTTAGTTCACTCCTCAACTCACAAAACCTAGCTTCATCGAGAGGCTTGGTAAAGATATCCGC[T/C]
AATTGTTTGTCGGTTCTCACATGTTGGATGTCTATGTCGCCTCTTGTGGAATGATCTCTCAAGAAATGGTGGCGAATATTGATATGTTTGGTTCGGGAGT
ACTCCCGAACCAAACATATCAATATTCGCCACCATTTCTTGAGAGATCATTCCACAAGAGGCGACATAGACATCCAACATGTGAGAACCGACAAACAATT[A/G]
GCGGATATCTTTACCAAGCCTCTCGATGAAGCTAGGTTTTGTGAGTTGAGGAGTGAACTAAATATTTTGGATTCTCGGAATGTGGCTTCATCTATTGCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 21.80% | 3.70% | 2.64% | NA |
| All Indica | 2759 | 61.80% | 27.70% | 6.02% | 4.46% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.00% | 0.13% | NA |
| Aus | 269 | 7.10% | 92.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 76.00% | 2.70% | 7.56% | 13.78% | NA |
| Indica II | 465 | 77.60% | 19.60% | 2.37% | 0.43% | NA |
| Indica III | 913 | 42.60% | 46.30% | 9.31% | 1.75% | NA |
| Indica Intermediate | 786 | 64.10% | 29.80% | 3.18% | 2.93% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 13.30% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825175613 | T -> C | LOC_Os08g39750.1 | downstream_gene_variant ; 4805.0bp to feature; MODIFIER | silent_mutation | Average:15.868; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| vg0825175613 | T -> C | LOC_Os08g39760.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.868; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| vg0825175613 | T -> DEL | N | N | silent_mutation | Average:15.868; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825175613 | NA | 9.60E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825175613 | 6.04E-12 | 5.62E-28 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825175613 | 1.69E-10 | 3.72E-12 | mr1874 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825175613 | NA | 3.07E-07 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825175613 | 3.61E-11 | 1.88E-39 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825175613 | 3.00E-09 | 2.74E-14 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |