Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825151239:

Variant ID: vg0825151239 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25151239
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTTAGCATCCATATAAAATTATATATATTTTTAATATGATTTTACTTAAAATTTATTAAATAGTTTTCTCATTATCTTTAGATTTTGAAAGTTCAAAC[C/A]
TTATCATCCTCTTATTTCTAGTTTTATAATTTTTAAAAGTCACACCAGTTGCTACCCTTTACTTTTGTCATATTATTCTTCATTTGATTGCTCGATCTAC

Reverse complement sequence

GTAGATCGAGCAATCAAATGAAGAATAATATGACAAAAGTAAAGGGTAGCAACTGGTGTGACTTTTAAAAATTATAAAACTAGAAATAAGAGGATGATAA[G/T]
GTTTGAACTTTCAAAATCTAAAGATAATGAGAAAACTATTTAATAAATTTTAAGTAAAATCATATTAAAAATATATATAATTTTATATGGATGCTAACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	11.00%	2.52%	0.00%	NA
All Indica	2759	77.90%	18.10%	4.02%	0.00%	NA
All Japonica	1512	98.90%	0.80%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	70.80%	19.00%	10.25%	0.00%	NA
Indica II	465	46.00%	48.20%	5.81%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	76.50%	20.60%	2.93%	0.00%	NA
Temperate Japonica	767	98.30%	1.30%	0.39%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	11.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825151239	C -> A	LOC_Os08g39720.1	upstream_gene_variant ; 4265.0bp to feature; MODIFIER	silent_mutation	Average:29.18; most accessible tissue: Callus, score: 53.213	N	N	N	N
vg0825151239	C -> A	LOC_Os08g39730.1	upstream_gene_variant ; 3919.0bp to feature; MODIFIER	silent_mutation	Average:29.18; most accessible tissue: Callus, score: 53.213	N	N	N	N
vg0825151239	C -> A	LOC_Os08g39720-LOC_Os08g39730	intergenic_region ; MODIFIER	silent_mutation	Average:29.18; most accessible tissue: Callus, score: 53.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825151239	NA	3.38E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	6.33E-06	NA	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	1.33E-06	8.83E-09	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	1.92E-09	NA	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	1.79E-08	6.77E-11	mr1874	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	1.93E-06	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	2.27E-06	9.40E-11	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	5.30E-08	NA	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151239	3.67E-07	9.42E-12	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251