Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825106864:

Variant ID: vg0825106864 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25106864
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTTGGTGAGGAGAGAACATCCTATAAATACTCAAAACAACAGCTGTAATAACTTGGCTTAGAACTCGGCGGCGGCGGTGGCTTGGTCCGGTTGGACGC[A/G]
AGAGAGAAATCTATTAATCGAGTTCCTCGTATCATCTTGTTCTTGTGTGCTTGTGTGAATCGTGAGCTAGGGTTCTAACAAAATCTGGTATCAGAGCTTC

Reverse complement sequence

GAAGCTCTGATACCAGATTTTGTTAGAACCCTAGCTCACGATTCACACAAGCACACAAGAACAAGATGATACGAGGAACTCGATTAATAGATTTCTCTCT[T/C]
GCGTCCAACCGGACCAAGCCACCGCCGCCGCCGAGTTCTAAGCCAAGTTATTACAGCTGTTGTTTTGAGTATTTATAGGATGTTCTCTCCTCACCAACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	23.90%	0.23%	0.02%	NA
All Indica	2759	68.90%	30.70%	0.40%	0.04%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	5.90%	94.10%	0.00%	0.00%	NA
Indica I	595	65.70%	33.40%	0.84%	0.00%	NA
Indica II	465	89.00%	10.80%	0.00%	0.22%	NA
Indica III	913	63.90%	36.00%	0.11%	0.00%	NA
Indica Intermediate	786	65.10%	34.20%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825106864	A -> G	LOC_Os08g39650.1	upstream_gene_variant ; 263.0bp to feature; MODIFIER	silent_mutation	Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0825106864	A -> G	LOC_Os08g39640.1	downstream_gene_variant ; 1248.0bp to feature; MODIFIER	silent_mutation	Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0825106864	A -> G	LOC_Os08g39660.1	downstream_gene_variant ; 2791.0bp to feature; MODIFIER	silent_mutation	Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0825106864	A -> G	LOC_Os08g39640-LOC_Os08g39650	intergenic_region ; MODIFIER	silent_mutation	Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0825106864	A -> DEL	N	N	silent_mutation	Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825106864	NA	5.18E-09	mr1545	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	8.20E-26	7.75E-50	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	1.45E-27	4.08E-34	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	NA	7.77E-08	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	NA	2.14E-10	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	2.39E-06	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	2.65E-06	7.03E-08	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	6.36E-33	1.29E-77	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864	2.06E-34	6.69E-48	mr1874_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251