Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824883472:

Variant ID: vg0824883472 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24883472
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACGGCGAGAGCTCGTCGGACGACGTGGAGGCGCCGCTGCTGCTGCCGGCGGCGAGGGGCGGGACGATGGCGAAGGGTGATCGTCGACGTCCGGCGTCG[T/G]
CGGCGGCGGCGGCGTGGGTGCGCGCTCTGCTCGCGCACAAGTACCCGGCGATCGCGGCGGGGCCGGCGGCGTGCGCGGCGGTGTGCGCCGCCGTGGACCT

Reverse complement sequence

AGGTCCACGGCGGCGCACACCGCCGCGCACGCCGCCGGCCCCGCCGCGATCGCCGGGTACTTGTGCGCGAGCAGAGCGCGCACCCACGCCGCCGCCGCCG[A/C]
CGACGCCGGACGTCGACGATCACCCTTCGCCATCGTCCCGCCCCTCGCCGCCGGCAGCAGCAGCGGCGCCTCCACGTCGTCCGACGAGCTCTCGCCGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.20% 0.68% 0.00% NA
All Indica  2759 78.50% 21.50% 0.00% 0.00% NA
All Japonica  1512 49.70% 48.30% 1.92% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 91.60% 8.40% 0.00% 0.00% NA
Indica III  913 59.30% 40.70% 0.00% 0.00% NA
Indica Intermediate  786 79.30% 20.70% 0.00% 0.00% NA
Temperate Japonica  767 85.00% 12.10% 2.87% 0.00% NA
Tropical Japonica  504 6.30% 92.70% 0.99% 0.00% NA
Japonica Intermediate  241 28.20% 71.00% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824883472 T -> G LOC_Os08g39370.1 missense_variant ; p.Ser41Ala; MODERATE nonsynonymous_codon ; S41A Average:89.299; most accessible tissue: Zhenshan97 young leaf, score: 95.273 unknown unknown TOLERATED 0.18

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0824883472 T G 0.02 0.01 0.03 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824883472 NA 1.81E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824883472 NA 4.11E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 1.77E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 4.31E-06 4.31E-06 mr1597 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 2.36E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 1.20E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 1.30E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 9.80E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 1.96E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 4.79E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824883472 NA 5.28E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251