Variant ID: vg0824869424 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 24869424 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
CTAACTGATTGAAGATTGGATAATTTATGCCTTTTCTGCCCATATACTAACTGATTGCCTTGTACTTCCACCAATCACAATTATGATGCTTTCTTTAATT[G/A]
TTTGGTGAAGTAGAGTAATAATTAATGCATTTTAATCTCTATGTCTGCAGGTTGTTTCACTAATTTGAATGTAAGCAGTAAGACAGATCATGGTATGTTT
AAACATACCATGATCTGTCTTACTGCTTACATTCAAATTAGTGAAACAACCTGCAGACATAGAGATTAAAATGCATTAATTATTACTCTACTTCACCAAA[C/T]
AATTAAAGAAAGCATCATAATTGTGATTGGTGGAAGTACAAGGCAATCAGTTAGTATATGGGCAGAAAAGGCATAAATTATCCAATCTTCAATCAGTTAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.80% | 10.80% | 0.34% | 0.02% | NA |
All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 73.80% | 25.10% | 1.06% | 0.07% | NA |
Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 92.20% | 5.70% | 1.96% | 0.13% | NA |
Tropical Japonica | 504 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 78.00% | 21.60% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0824869424 | G -> A | LOC_Os08g39350.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
vg0824869424 | G -> DEL | N | N | silent_mutation | Average:57.216; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0824869424 | NA | 2.82E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824869424 | 2.08E-06 | 2.07E-06 | mr1601 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824869424 | NA | 8.32E-07 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824869424 | NA | 8.84E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824869424 | NA | 1.43E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824869424 | NA | 6.44E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824869424 | NA | 1.50E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |