Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824413447:

Variant ID: vg0824413447 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 24413447
Reference Allele: T	Alternative Allele: C,TAAGCATTTTATC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAAAGGTTGTTTGCTCAAGATCAGAAAGATGGAAACTCAAAAGTGAATAGTGTACCTGTCTAGTTGAAATATATTGTGCGTGCAAATAAGCATTTTAT[T/C,TAAGCATTTTATC]
AAACAGGGGAAAACATTGTTCTGATAAATTTACCTCAGAATTGATTAACTCGGTTCAGCTGTTTGGGGAGCAGACAACCAGGGCTGGTACTAACTTCTTG

Reverse complement sequence

CAAGAAGTTAGTACCAGCCCTGGTTGTCTGCTCCCCAAACAGCTGAACCGAGTTAATCAATTCTGAGGTAAATTTATCAGAACAATGTTTTCCCCTGTTT[A/G,GATAAAATGCTTA]
ATAAAATGCTTATTTGCACGCACAATATATTTCAACTAGACAGGTACACTATTCACTTTTGAGTTTCCATCTTTCTGATCTTGAGCAAACAACCTTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	8.90%	8.06%	0.00%	TAAGCATTTTATC: 0.02%
All Indica	2759	92.20%	0.70%	7.10%	0.00%	NA
All Japonica	1512	62.90%	25.80%	11.24%	0.00%	TAAGCATTTTATC: 0.07%
Aus	269	97.40%	0.00%	2.60%	0.00%	NA
Indica I	595	79.80%	1.30%	18.82%	0.00%	NA
Indica II	465	93.30%	0.60%	6.02%	0.00%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	92.20%	0.90%	6.87%	0.00%	NA
Temperate Japonica	767	34.60%	46.90%	18.51%	0.00%	NA
Tropical Japonica	504	95.40%	2.20%	2.18%	0.00%	TAAGCATTTTATC: 0.20%
Japonica Intermediate	241	85.10%	7.90%	7.05%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	14.40%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824413447	T -> TAAGCATTTTATC	LOC_Os08g38630.1	upstream_gene_variant ; 831.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> TAAGCATTTTATC	LOC_Os08g38640.1	upstream_gene_variant ; 2981.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> TAAGCATTTTATC	LOC_Os08g38620.1	downstream_gene_variant ; 630.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> TAAGCATTTTATC	LOC_Os08g38620.2	downstream_gene_variant ; 630.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> TAAGCATTTTATC	LOC_Os08g38620.3	downstream_gene_variant ; 630.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> TAAGCATTTTATC	LOC_Os08g38620-LOC_Os08g38630	intergenic_region ; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> C	LOC_Os08g38630.1	upstream_gene_variant ; 832.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> C	LOC_Os08g38640.1	upstream_gene_variant ; 2982.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> C	LOC_Os08g38620.1	downstream_gene_variant ; 629.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> C	LOC_Os08g38620.2	downstream_gene_variant ; 629.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> C	LOC_Os08g38620.3	downstream_gene_variant ; 629.0bp to feature; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N
vg0824413447	T -> C	LOC_Os08g38620-LOC_Os08g38630	intergenic_region ; MODIFIER	silent_mutation	Average:71.036; most accessible tissue: Callus, score: 84.299	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824413447	NA	2.11E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	6.10E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	9.71E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	4.34E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	1.25E-06	9.56E-08	mr1955	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	7.64E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	8.85E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	3.23E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	1.13E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447	NA	5.05E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251