Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824393669:

Variant ID: vg0824393669 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 24393669
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACAAGAGCAAAACATTGCCGAGAATGAGAGAAACGAAGACCAAAGCTCTGTTACTGTCGTCGTCGACGGTGAGGCCGGCCCGGCCATGCAGGACGAAC[A/G]
GGTAGGTTATTACCCGCGGCGGCCGGAGAAGTGGCTGAGGCGGCCGGAGGGGGAGAACATGAGGAGGGCGACGTCGATGTCGCAGAGCACGGACAGCTCG

Reverse complement sequence

CGAGCTGTCCGTGCTCTGCGACATCGACGTCGCCCTCCTCATGTTCTCCCCCTCCGGCCGCCTCAGCCACTTCTCCGGCCGCCGCGGGTAATAACCTACC[T/C]
GTTCGTCCTGCATGGCCGGGCCGGCCTCACCGTCGACGACGACAGTAACAGAGCTTTGGTCTTCGTTTCTCTCATTCTCGGCAATGTTTTGCTCTTGTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.10%	17.80%	1.93%	0.19%	NA
All Indica	2759	95.30%	3.80%	0.80%	0.04%	NA
All Japonica	1512	63.80%	32.10%	3.90%	0.26%	NA
Aus	269	14.10%	83.30%	2.23%	0.37%	NA
Indica I	595	99.20%	0.00%	0.84%	0.00%	NA
Indica II	465	93.50%	4.50%	1.94%	0.00%	NA
Indica III	913	94.90%	5.00%	0.11%	0.00%	NA
Indica Intermediate	786	94.00%	5.00%	0.89%	0.13%	NA
Temperate Japonica	767	83.40%	12.50%	3.78%	0.26%	NA
Tropical Japonica	504	30.60%	65.50%	3.77%	0.20%	NA
Japonica Intermediate	241	70.50%	24.50%	4.56%	0.41%	NA
VI/Aromatic	96	81.20%	16.70%	1.04%	1.04%	NA
Intermediate	90	83.30%	11.10%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824393669	A -> G	LOC_Os08g38580.1	upstream_gene_variant ; 3207.0bp to feature; MODIFIER	silent_mutation	Average:67.573; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0824393669	A -> G	LOC_Os08g38570.1	downstream_gene_variant ; 4553.0bp to feature; MODIFIER	silent_mutation	Average:67.573; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0824393669	A -> G	LOC_Os08g38600.1	downstream_gene_variant ; 4245.0bp to feature; MODIFIER	silent_mutation	Average:67.573; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0824393669	A -> G	LOC_Os08g38590.1	intron_variant ; MODIFIER	silent_mutation	Average:67.573; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0824393669	A -> DEL	N	N	silent_mutation	Average:67.573; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824393669	NA	2.58E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824393669	NA	3.90E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824393669	NA	1.02E-11	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824393669	1.11E-06	NA	mr1741	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824393669	NA	5.27E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824393669	NA	1.08E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824393669	NA	9.41E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251