Variant ID: vg0824350881 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 24350881 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATAATTAAGAAAAACTATTTACCGATCTATTTATCTTAGAGTTTCGCTCCAATCTAAAGTTTCATTTCTCGCGTATAAATTCAAAATTCTTCTTTGTC[G/A]
AAGATTCATCCTAGCTTAGCAACACTCACGGTGGATAAAGCAGCCCATGCTCTGGTTTCTATTTTTTGTGGTTTTTTTTATCAAAGTATTCTTTGTTTTT
AAAAACAAAGAATACTTTGATAAAAAAAACCACAAAAAATAGAAACCAGAGCATGGGCTGCTTTATCCACCGTGAGTGTTGCTAAGCTAGGATGAATCTT[C/T]
GACAAAGAAGAATTTTGAATTTATACGCGAGAAATGAAACTTTAGATTGGAGCGAAACTCTAAGATAAATAGATCGGTAAATAGTTTTTCTTAATTATAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.20% | 5.60% | 0.17% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 82.60% | 16.90% | 0.53% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.50% | 2.30% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 59.30% | 39.70% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 83.80% | 15.40% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0824350881 | G -> A | LOC_Os08g38480.1 | upstream_gene_variant ; 846.0bp to feature; MODIFIER | silent_mutation | Average:28.795; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0824350881 | G -> A | LOC_Os08g38470.1 | downstream_gene_variant ; 2853.0bp to feature; MODIFIER | silent_mutation | Average:28.795; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0824350881 | G -> A | LOC_Os08g38470-LOC_Os08g38480 | intergenic_region ; MODIFIER | silent_mutation | Average:28.795; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0824350881 | NA | 1.04E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824350881 | NA | 6.89E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824350881 | 1.58E-06 | 3.80E-18 | mr1769 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824350881 | NA | 1.06E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824350881 | NA | 2.26E-18 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |