Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823456313:

Variant ID: vg0823456313 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 23456313
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATACATATATTGAAAAAAAAACTTTCTTTTACCATATTGCTTACATCACTTGTTTTTAAGTTACCATCTATCTATTATATTATTAAAACAGCTTTGAA[A/G]
GGAGGCACTACGTTCGCTGTGGAGGCTAGAAATTCCCACATTAATCGGAGAAAAAAAAAGTTCAAGTCGAAATACAATTTAAAAAGAGCAGAAATTCAGA

Reverse complement sequence

TCTGAATTTCTGCTCTTTTTAAATTGTATTTCGACTTGAACTTTTTTTTTCTCCGATTAATGTGGGAATTTCTAGCCTCCACAGCGAACGTAGTGCCTCC[T/C]
TTCAAAGCTGTTTTAATAATATAATAGATAGATGGTAACTTAAAAACAAGTGATGTAAGCAATATGGTAAAAGAAAGTTTTTTTTTCAATATATGTATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	8.50%	6.50%	0.00%	NA
All Indica	2759	75.20%	14.00%	10.87%	0.00%	NA
All Japonica	1512	99.20%	0.70%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	76.10%	3.40%	20.50%	0.00%	NA
Indica II	465	31.20%	48.60%	20.22%	0.00%	NA
Indica III	913	99.50%	0.10%	0.44%	0.00%	NA
Indica Intermediate	786	72.30%	17.60%	10.18%	0.00%	NA
Temperate Japonica	767	99.00%	0.90%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	10.00%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823456313	A -> G	LOC_Os08g37115.1	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 80.841	N	N	N	N
vg0823456313	A -> G	LOC_Os08g37120.1	downstream_gene_variant ; 4032.0bp to feature; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 80.841	N	N	N	N
vg0823456313	A -> G	LOC_Os08g37115-LOC_Os08g37120	intergenic_region ; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 80.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823456313	NA	2.21E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	1.26E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	2.01E-07	mr1105_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	5.42E-08	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	6.99E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	3.08E-09	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	9.66E-06	NA	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	2.04E-10	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	7.11E-06	mr1763_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823456313	NA	1.75E-07	mr1944_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251