Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822295827:

Variant ID: vg0822295827 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22295827
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGAGGCGTGTGACGATGGCTTCGGCTGCCCGGCGAGTAGCGTAGGCAGCGGCGGCGATTCCTGATGCGGCAGTTGAGAGGAGGAAGAGGCAGAGAGGA[G/A]
GTCCCGGCGGTGGCAACGATGGTCTTGGCGCGGCAGCCGAGAGGAGGAAGAGTCGGCGGGGAGGAGGTCCCGGCGGCGGTGAAGACGGTCCTGGCACAAC

Reverse complement sequence

GTTGTGCCAGGACCGTCTTCACCGCCGCCGGGACCTCCTCCCCGCCGACTCTTCCTCCTCTCGGCTGCCGCGCCAAGACCATCGTTGCCACCGCCGGGAC[C/T]
TCCTCTCTGCCTCTTCCTCCTCTCAACTGCCGCATCAGGAATCGCCGCCGCTGCCTACGCTACTCGCCGGGCAGCCGAAGCCATCGTCACACGCCTCCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.00% 0.23% 0.04% NA
All Indica  2759 97.90% 1.80% 0.25% 0.04% NA
All Japonica  1512 1.50% 98.30% 0.13% 0.07% NA
Aus  269 54.30% 45.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.34% 0.17% NA
Indica II  465 98.10% 1.50% 0.43% 0.00% NA
Indica III  913 98.90% 1.00% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 4.20% 0.25% 0.00% NA
Temperate Japonica  767 1.30% 98.60% 0.00% 0.13% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822295827 G -> A LOC_Os08g35350.1 upstream_gene_variant ; 3442.0bp to feature; MODIFIER silent_mutation Average:75.814; most accessible tissue: Zhenshan97 flower, score: 87.73 N N N N
vg0822295827 G -> A LOC_Os08g35370.1 downstream_gene_variant ; 1224.0bp to feature; MODIFIER silent_mutation Average:75.814; most accessible tissue: Zhenshan97 flower, score: 87.73 N N N N
vg0822295827 G -> A LOC_Os08g35350-LOC_Os08g35370 intergenic_region ; MODIFIER silent_mutation Average:75.814; most accessible tissue: Zhenshan97 flower, score: 87.73 N N N N
vg0822295827 G -> DEL N N silent_mutation Average:75.814; most accessible tissue: Zhenshan97 flower, score: 87.73 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0822295827 G A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822295827 NA 4.71E-30 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.22E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 3.35E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 7.55E-09 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.77E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 4.91E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.45E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 3.65E-50 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.13E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.44E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.28E-30 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 7.86E-37 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 1.89E-08 8.13E-17 mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 2.38E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 2.12E-37 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 7.97E-07 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 8.82E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 2.88E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 2.04E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 6.43E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.47E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 6.82E-62 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 2.64E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 5.60E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.13E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.72E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 3.24E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 4.14E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.35E-44 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 2.50E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822295827 NA 1.57E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251