Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822230939:

Variant ID: vg0822230939 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 22230939
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTACTCTTGGGGACTAAGGTCTCCTAGACGGCTAGGCGTCGCCGGTGAGCACCTAAGGTTGTGGTGTGCCACGGAAAGTTTGTGAAGGCTTCGATTT[T/C]
GCCTCCGCAAGGGAAGAAATCAAGAGTGAAACCGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATAGGCCTGGCCCTTGTGGCTCCTCAA

Reverse complement sequence

TTGAGGAGCCACAAGGGCCAGGCCTATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCGGTTTCACTCTTGATTTCTTCCCTTGCGGAGGC[A/G]
AAATCGAAGCCTTCACAAACTTTCCGTGGCACACCACAACCTTAGGTGCTCACCGGCGACGCCTAGCCGTCTAGGAGACCTTAGTCCCCAAGAGTAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	36.70%	0.28%	0.00%	NA
All Indica	2759	97.40%	2.20%	0.40%	0.00%	NA
All Japonica	1512	1.40%	98.50%	0.13%	0.00%	NA
Aus	269	49.10%	50.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.20%	0.34%	0.00%	NA
Indica II	465	97.80%	1.50%	0.65%	0.00%	NA
Indica III	913	98.20%	1.50%	0.22%	0.00%	NA
Indica Intermediate	786	94.40%	5.10%	0.51%	0.00%	NA
Temperate Japonica	767	1.20%	98.60%	0.26%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0822230939	T -> C	LOC_Os08g35220.1	upstream_gene_variant ; 3452.0bp to feature; MODIFIER	silent_mutation	Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0822230939	T -> C	LOC_Os08g35230.1	upstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0822230939	T -> C	LOC_Os08g35220.2	upstream_gene_variant ; 3478.0bp to feature; MODIFIER	silent_mutation	Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0822230939	T -> C	LOC_Os08g35220-LOC_Os08g35230	intergenic_region ; MODIFIER	silent_mutation	Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0822230939	NA	6.14E-25	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822230939	NA	2.11E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822230939	3.21E-06	NA	mr1047_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822230939	NA	7.11E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251