Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822155831:

Variant ID: vg0822155831 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 22155831
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AAGATGACGAGAATCTCTTCCAGTTCGAGAGGACGAACTAGATGCATATAAATAAATATTACTCCCTCCATCTATTTTTGATAGTCATATTTCCAAATCT[G/A]
AAAATTTTATTTTTGATAAGCATATTTCAATCCAACGACCTATCATCTTAATGATTTTCTCGAATTTAATGCGTGACTCTCCATTCTTCCATACATGATT

Reverse complement sequence

AATCATGTATGGAAGAATGGAGAGTCACGCATTAAATTCGAGAAAATCATTAAGATGATAGGTCGTTGGATTGAAATATGCTTATCAAAAATAAAATTTT[C/T]
AGATTTGGAAATATGACTATCAAAAATAGATGGAGGGAGTAATATTTATTTATATGCATCTAGTTCGTCCTCTCGAACTGGAAGAGATTCTCGTCATCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	26.60%	3.72%	0.00%	NA
All Indica	2759	48.80%	44.90%	6.27%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	47.90%	37.30%	14.79%	0.00%	NA
Indica II	465	75.50%	20.00%	4.52%	0.00%	NA
Indica III	913	31.20%	67.70%	1.10%	0.00%	NA
Indica Intermediate	786	54.10%	39.10%	6.87%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0822155831	G -> A	LOC_Os08g35140.1	upstream_gene_variant ; 4968.0bp to feature; MODIFIER	silent_mutation	Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0822155831	G -> A	LOC_Os08g35150.1	upstream_gene_variant ; 1001.0bp to feature; MODIFIER	silent_mutation	Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0822155831	G -> A	LOC_Os08g35160.1	upstream_gene_variant ; 3775.0bp to feature; MODIFIER	silent_mutation	Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0822155831	G -> A	LOC_Os08g35160.2	upstream_gene_variant ; 3677.0bp to feature; MODIFIER	silent_mutation	Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0822155831	G -> A	LOC_Os08g35160.3	upstream_gene_variant ; 3775.0bp to feature; MODIFIER	silent_mutation	Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0822155831	G -> A	LOC_Os08g35150-LOC_Os08g35160	intergenic_region ; MODIFIER	silent_mutation	Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0822155831	NA	1.02E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822155831	1.77E-06	NA	mr1469_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822155831	3.25E-06	3.07E-08	mr1469_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251