Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821779217:

Variant ID: vg0821779217 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21779217
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGCCAAATATTTCTTAATGTTGATCATGTGTCATGAAGCTCTGGCTCAGGAAAGCCGAGTGGATAATAATAACTTAAATGCTAGTTTAGATGATAGTG[C/T]
AATATCATGTGTAGCCGAACCAAATGACGGTTCGGATTGTGTTAATAATTTGTGCAATGATGCCATAGCAATTATAGCCGAACCAAATGTTGGTTCGGAT

Reverse complement sequence

ATCCGAACCAACATTTGGTTCGGCTATAATTGCTATGGCATCATTGCACAAATTATTAACACAATCCGAACCGTCATTTGGTTCGGCTACACATGATATT[G/A]
CACTATCATCTAAACTAGCATTTAAGTTATTATTATCCACTCGGCTTTCCTGAGCCAGAGCTTCATGACACATGATCAACATTAAGAAATATTTGGCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 9.10% 1.02% 0.74% NA
All Indica  2759 99.70% 0.30% 0.07% 0.00% NA
All Japonica  1512 67.60% 27.10% 2.98% 2.31% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 17.70% 67.70% 7.94% 6.75% NA
Japonica Intermediate  241 72.20% 25.30% 2.07% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821779217 C -> T LOC_Os08g34680.1 downstream_gene_variant ; 4948.0bp to feature; MODIFIER silent_mutation Average:33.646; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0821779217 C -> T LOC_Os08g34670.1 intron_variant ; MODIFIER silent_mutation Average:33.646; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0821779217 C -> DEL N N silent_mutation Average:33.646; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821779217 NA 1.63E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 2.99E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 4.74E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 7.80E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 1.50E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 4.11E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 3.63E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 1.17E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 9.94E-07 1.68E-40 mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 5.03E-21 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 5.35E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 2.18E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 3.98E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 2.29E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 4.78E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 4.40E-23 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 9.41E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 5.73E-34 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 1.55E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 1.44E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 3.82E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821779217 NA 1.02E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251