Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820845566:

Variant ID: vg0820845566 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20845566
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTATAGATAACATAAAATTAAAAAATCAACTCAAACACGAATGACGTATCAAAGTACCGGCAAAAAAACATCTTTAATTTTTATAATAGTAGAGATAT[A/G]
AATCGTACGCATGTATCTTTTGTCTTGAAAAGTATAATTATTATTATGTCATTAACTTACTGAATTTATATAATACAAAATTAACCAAAGTTTCAAAACA

Reverse complement sequence

TGTTTTGAAACTTTGGTTAATTTTGTATTATATAAATTCAGTAAGTTAATGACATAATAATAATTATACTTTTCAAGACAAAAGATACATGCGTACGATT[T/C]
ATATCTCTACTATTATAAAAATTAAAGATGTTTTTTTGCCGGTACTTTGATACGTCATTCGTGTTTGAGTTGATTTTTTAATTTTATGTTATCTATACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.40% 0.02% 0.00% NA
All Indica  2759 94.10% 5.90% 0.04% 0.00% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 93.50% 6.50% 0.00% 0.00% NA
Indica Intermediate  786 90.10% 9.90% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820845566 A -> G LOC_Os08g33410.1 upstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:82.62; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0820845566 A -> G LOC_Os08g33420.1 upstream_gene_variant ; 2458.0bp to feature; MODIFIER silent_mutation Average:82.62; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0820845566 A -> G LOC_Os08g33410-LOC_Os08g33420 intergenic_region ; MODIFIER silent_mutation Average:82.62; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820845566 A G 0.02 0.02 0.0 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820845566 NA 2.39E-65 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 1.37E-25 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 2.13E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 1.04E-32 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 4.87E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 9.55E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 7.63E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 3.43E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 3.87E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 3.87E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 7.45E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 6.65E-24 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 1.19E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 2.29E-27 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 1.43E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 6.38E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 1.01E-06 NA mr1770 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 5.72E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 2.05E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 1.14E-22 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820845566 NA 1.58E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251