Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820445810:

Variant ID: vg0820445810 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20445810
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CACATACATATAAATGCATGTGTTTAGATTCATTACCATCTAAATGAATGTGGACAATGATAGAAAGTCTTACATTGTGAAACGGATGGAGTATATAACT[A/G]
TCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATATCGGCAAGATCCACCACATACCATGTCTTATACGGAAACTGACCTCGAGGGAGTTC

Reverse complement sequence

GAACTCCCTCGAGGTCAGTTTCCGTATAAGACATGGTATGTGGTGGATCTTGCCGATATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGA[T/C]
AGTTATATACTCCATCCGTTTCACAATGTAAGACTTTCTATCATTGTCCACATTCATTTAGATGGTAATGAATCTAAACACATGCATTTATATGTATGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	24.20%	0.19%	9.48%	NA
All Indica	2759	75.20%	8.40%	0.33%	16.06%	NA
All Japonica	1512	44.20%	55.70%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.10%	1.30%	0.34%	1.18%	NA
Indica II	465	84.30%	12.30%	0.43%	3.01%	NA
Indica III	913	56.50%	10.10%	0.33%	33.08%	NA
Indica Intermediate	786	74.80%	9.70%	0.25%	15.27%	NA
Temperate Japonica	767	27.10%	72.90%	0.00%	0.00%	NA
Tropical Japonica	504	69.40%	30.40%	0.00%	0.20%	NA
Japonica Intermediate	241	46.10%	53.90%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	60.00%	35.60%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820445810	A -> G	LOC_Os08g32950.1	upstream_gene_variant ; 748.0bp to feature; MODIFIER	silent_mutation	Average:37.758; most accessible tissue: Callus, score: 64.829	N	N	N	N
vg0820445810	A -> G	LOC_Os08g32960.1	downstream_gene_variant ; 4215.0bp to feature; MODIFIER	silent_mutation	Average:37.758; most accessible tissue: Callus, score: 64.829	N	N	N	N
vg0820445810	A -> G	LOC_Os08g32940-LOC_Os08g32950	intergenic_region ; MODIFIER	silent_mutation	Average:37.758; most accessible tissue: Callus, score: 64.829	N	N	N	N
vg0820445810	A -> DEL	N	N	silent_mutation	Average:37.758; most accessible tissue: Callus, score: 64.829	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820445810	NA	4.23E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	3.38E-06	1.77E-08	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	2.19E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	4.39E-06	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	1.72E-07	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	1.35E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	3.81E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	3.72E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	5.96E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	1.99E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	6.56E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	1.33E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	2.42E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	7.91E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	3.10E-06	2.00E-08	mr1620	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820445810	NA	5.45E-07	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251