Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820098280:

Variant ID: vg0820098280 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20098280
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.24, T: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGGTTTCTCTTGATAAATGTCTCTTTGCATGTCATATATTATTACTATATTTTTTTTATATAGAATGGCTATATGTAACTAATACAAATATTAAACTT[G/A]
AAAAAAGAAAAATCTCAAATCTCATAGTATCCCATGCTACGATACAATACTACTTTAAGAAAAACGGTACTACCTAGTATCCTGATACTGATAACCTTGG

Reverse complement sequence

CCAAGGTTATCAGTATCAGGATACTAGGTAGTACCGTTTTTCTTAAAGTAGTATTGTATCGTAGCATGGGATACTATGAGATTTGAGATTTTTCTTTTTT[C/T]
AAGTTTAATATTTGTATTAGTTACATATAGCCATTCTATATAAAAAAAATATAGTAATAATATATGACATGCAAAGAGACATTTATCAAGAGAAACCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 33.30% 0.02% 0.00% NA
All Indica  2759 94.80% 5.20% 0.00% 0.00% NA
All Japonica  1512 10.10% 89.90% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 95.00% 5.00% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 24.40% 75.60% 0.00% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820098280 G -> A LOC_Os08g32450.1 downstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:36.288; most accessible tissue: Callus, score: 69.038 N N N N
vg0820098280 G -> A LOC_Os08g32460.1 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:36.288; most accessible tissue: Callus, score: 69.038 N N N N
vg0820098280 G -> A LOC_Os08g32460-LOC_Os08g32470 intergenic_region ; MODIFIER silent_mutation Average:36.288; most accessible tissue: Callus, score: 69.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820098280 NA 4.30E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 2.99E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 7.92E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 6.13E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.32E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 8.58E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 7.99E-07 2.22E-07 mr1157 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 4.15E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 3.83E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 2.08E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.13E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 3.27E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.72E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.58E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 7.35E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.42E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 6.47E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.21E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 2.55E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 5.52E-08 4.49E-09 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.21E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 6.72E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.59E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 6.78E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 8.23E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.05E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 2.65E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 8.07E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 5.30E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.25E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 9.16E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 1.11E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820098280 NA 8.08E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251