Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819969492:

Variant ID: vg0819969492 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19969492
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAAGATTTGGAACTTAACCCTTAGTTGATGATAGGAAATTCCACATAAAGAAATTCTCATTTAGCTCCTGATCTTACTAACTCTTAACCGACTTTCCC[C/A]
TCAGTAATAACTACTGGCATGACTGTCCTTCTTCTGACCTGACTTCGGTGTCGTCCACCTAAATGGGTTGTGTAGTTGATATCTCAAAACTAAACTGACC

Reverse complement sequence

GGTCAGTTTAGTTTTGAGATATCAACTACACAACCCATTTAGGTGGACGACACCGAAGTCAGGTCAGAAGAAGGACAGTCATGCCAGTAGTTATTACTGA[G/T]
GGGAAAGTCGGTTAAGAGTTAGTAAGATCAGGAGCTAAATGAGAATTTCTTTATGTGGAATTTCCTATCATCAACTAAGGGTTAAGTTCCAAATCTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.60%	0.10%	40.35%	37.90%	NA
All Indica	2759	8.40%	0.20%	53.57%	37.80%	NA
All Japonica	1512	47.00%	0.00%	9.39%	43.65%	NA
Aus	269	13.00%	0.40%	59.85%	26.77%	NA
Indica I	595	11.60%	0.20%	37.48%	50.76%	NA
Indica II	465	4.10%	0.60%	51.40%	43.87%	NA
Indica III	913	8.80%	0.00%	63.96%	27.27%	NA
Indica Intermediate	786	8.30%	0.10%	54.96%	36.64%	NA
Temperate Japonica	767	66.20%	0.00%	1.43%	32.33%	NA
Tropical Japonica	504	12.70%	0.00%	19.44%	67.86%	NA
Japonica Intermediate	241	57.30%	0.00%	13.69%	29.05%	NA
VI/Aromatic	96	7.30%	0.00%	92.71%	0.00%	NA
Intermediate	90	41.10%	0.00%	41.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819969492	C -> A	LOC_Os08g32220.1	upstream_gene_variant ; 3248.0bp to feature; MODIFIER	silent_mutation	Average:9.133; most accessible tissue: Callus, score: 23.961	N	N	N	N
vg0819969492	C -> A	LOC_Os08g32190.1	downstream_gene_variant ; 4230.0bp to feature; MODIFIER	silent_mutation	Average:9.133; most accessible tissue: Callus, score: 23.961	N	N	N	N
vg0819969492	C -> A	LOC_Os08g32200.1	downstream_gene_variant ; 1982.0bp to feature; MODIFIER	silent_mutation	Average:9.133; most accessible tissue: Callus, score: 23.961	N	N	N	N
vg0819969492	C -> A	LOC_Os08g32210.1	intron_variant ; MODIFIER	silent_mutation	Average:9.133; most accessible tissue: Callus, score: 23.961	N	N	N	N
vg0819969492	C -> DEL	N	N	silent_mutation	Average:9.133; most accessible tissue: Callus, score: 23.961	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819969492	1.87E-06	1.87E-06	mr1234	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	2.14E-06	2.14E-06	mr1237	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	3.56E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	1.26E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	2.88E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	2.96E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	7.10E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	1.73E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819969492	NA	2.65E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251