Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819942032:

Variant ID: vg0819942032 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19942032
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACATAGTGGTTGCAGTGTCCTGCATAGCATCTTAAAGTTCTGAGTTTAAATATTCATAGGAGTGAATTTCACATTGGGTTGTTTGCGGGGCTAAGTT[T/C]
CCAATTTAAATGGCTGCATATATATATCGGGTTGGATATAGAAGCCAGGTAAAAAAAAATCATTCTCTTAAAAAAACTCGTCCTAATTGACGACCCATCC

Reverse complement sequence

GGATGGGTCGTCAATTAGGACGAGTTTTTTTAAGAGAATGATTTTTTTTTACCTGGCTTCTATATCCAACCCGATATATATATGCAGCCATTTAAATTGG[A/G]
AACTTAGCCCCGCAAACAACCCAATGTGAAATTCACTCCTATGAATATTTAAACTCAGAACTTTAAGATGCTATGCAGGACACTGCAACCACTATGTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.70% 0.11% 0.00% NA
All Indica  2759 85.40% 14.50% 0.11% 0.00% NA
All Japonica  1512 50.30% 49.70% 0.07% 0.00% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 71.40% 28.20% 0.34% 0.00% NA
Indica II  465 91.40% 8.60% 0.00% 0.00% NA
Indica III  913 89.70% 10.20% 0.11% 0.00% NA
Indica Intermediate  786 87.30% 12.70% 0.00% 0.00% NA
Temperate Japonica  767 39.00% 60.90% 0.13% 0.00% NA
Tropical Japonica  504 71.60% 28.40% 0.00% 0.00% NA
Japonica Intermediate  241 41.50% 58.50% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819942032 T -> C LOC_Os08g32130.2 downstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:82.479; most accessible tissue: Zhenshan97 young leaf, score: 95.033 N N N N
vg0819942032 T -> C LOC_Os08g32140.1 downstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:82.479; most accessible tissue: Zhenshan97 young leaf, score: 95.033 N N N N
vg0819942032 T -> C LOC_Os08g32150.1 downstream_gene_variant ; 4315.0bp to feature; MODIFIER silent_mutation Average:82.479; most accessible tissue: Zhenshan97 young leaf, score: 95.033 N N N N
vg0819942032 T -> C LOC_Os08g32130.1 downstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:82.479; most accessible tissue: Zhenshan97 young leaf, score: 95.033 N N N N
vg0819942032 T -> C LOC_Os08g32130-LOC_Os08g32140 intergenic_region ; MODIFIER silent_mutation Average:82.479; most accessible tissue: Zhenshan97 young leaf, score: 95.033 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819942032 T C -0.04 -0.04 -0.04 -0.02 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819942032 NA 8.95E-08 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 1.02E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 4.09E-06 1.65E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 6.60E-07 mr1228_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 2.30E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 5.43E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 9.63E-07 NA mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 2.01E-10 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 7.29E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819942032 NA 8.66E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251