Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819940770:

Variant ID: vg0819940770 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19940770
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAACCCTTCTAAAATAGGAGAGAAAAAACTATGGGCGCCAGCAAAATATCTTCACTATATATAGGGTGAGGTTACGTCGCCGCACGGCGGCTTACAA[A/G]
AGGTATATATATGGTGGAACCCTAAAAGGGATGACGATCCGTTTCCACCGCACCCCGGGCGTCCGCTCCACTACGGTAGAAGCCGGTCTTTATTAAGTGC

Reverse complement sequence

GCACTTAATAAAGACCGGCTTCTACCGTAGTGGAGCGGACGCCCGGGGTGCGGTGGAAACGGATCGTCATCCCTTTTAGGGTTCCACCATATATATACCT[T/C]
TTGTAAGCCGCCGTGCGGCGACGTAACCTCACCCTATATATAGTGAAGATATTTTGCTGGCGCCCATAGTTTTTTCTCTCCTATTTTAGAAGGGTTTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 28.40% 2.31% 11.47% NA
All Indica  2759 29.80% 47.60% 3.84% 18.74% NA
All Japonica  1512 99.20% 0.70% 0.00% 0.13% NA
Aus  269 96.70% 0.40% 0.74% 2.23% NA
Indica I  595 47.20% 49.60% 1.85% 1.34% NA
Indica II  465 12.30% 74.80% 2.58% 10.32% NA
Indica III  913 25.30% 35.20% 3.94% 35.60% NA
Indica Intermediate  786 32.20% 44.50% 5.98% 17.30% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 87.50% 1.00% 1.04% 10.42% NA
Intermediate  90 72.20% 20.00% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819940770 A -> G LOC_Os08g32130.2 downstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:69.504; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N
vg0819940770 A -> G LOC_Os08g32140.1 downstream_gene_variant ; 1979.0bp to feature; MODIFIER silent_mutation Average:69.504; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N
vg0819940770 A -> G LOC_Os08g32130.1 downstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:69.504; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N
vg0819940770 A -> G LOC_Os08g32130-LOC_Os08g32140 intergenic_region ; MODIFIER silent_mutation Average:69.504; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N
vg0819940770 A -> DEL N N silent_mutation Average:69.504; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819940770 A G -0.04 0.04 0.02 0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819940770 NA 1.17E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 2.37E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 4.56E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 3.25E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 3.18E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 6.09E-06 NA mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 6.73E-06 NA mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 9.57E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 1.11E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 1.33E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 7.27E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 1.80E-06 NA mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 6.07E-07 6.41E-06 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 3.88E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 5.03E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819940770 NA 6.72E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251