Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819934549:

Variant ID: vg0819934549 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19934549
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCAAATATTATTAGTAGATAAACGGCTTTTTATACTATTATTAGAACTCATAAAATCAACGATTAAAATTACTACTACTCAAATACCAAGCAGGGAGT[G/A]
TGCGATTGCCGGTTGCTGCATAAGCAAGCCTACATTTCGACAAACCGCATGCCAACAGTGACCTGCATGGGAGAAATTAAGATGATGAGATGGTTTGCCA

Reverse complement sequence

TGGCAAACCATCTCATCATCTTAATTTCTCCCATGCAGGTCACTGTTGGCATGCGGTTTGTCGAAATGTAGGCTTGCTTATGCAGCAACCGGCAATCGCA[C/T]
ACTCCCTGCTTGGTATTTGAGTAGTAGTAATTTTAATCGTTGATTTTATGAGTTCTAATAATAGTATAAAAAGCCGTTTATCTACTAATAATATTTGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.60% 0.11% 0.00% NA
All Indica  2759 36.00% 63.90% 0.11% 0.00% NA
All Japonica  1512 91.60% 8.30% 0.13% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 38.50% 61.50% 0.00% 0.00% NA
Indica II  465 8.40% 91.60% 0.00% 0.00% NA
Indica III  913 47.00% 53.00% 0.00% 0.00% NA
Indica Intermediate  786 37.80% 61.80% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 79.40% 20.20% 0.40% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819934549 G -> A LOC_Os08g32130.2 upstream_gene_variant ; 2507.0bp to feature; MODIFIER silent_mutation Average:47.377; most accessible tissue: Zhenshan97 flower, score: 78.5 N N N N
vg0819934549 G -> A LOC_Os08g32130.1 upstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:47.377; most accessible tissue: Zhenshan97 flower, score: 78.5 N N N N
vg0819934549 G -> A LOC_Os08g32120-LOC_Os08g32130 intergenic_region ; MODIFIER silent_mutation Average:47.377; most accessible tissue: Zhenshan97 flower, score: 78.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819934549 NA 1.12E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819934549 NA 2.08E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819934549 NA 7.82E-08 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 2.35E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 6.50E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 8.43E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 9.53E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 9.70E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 2.31E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 1.41E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 9.85E-06 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 3.11E-09 mr1566_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 1.44E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 1.61E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 2.91E-23 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 7.35E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 4.22E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 7.00E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 8.38E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 5.59E-09 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 9.77E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 8.48E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 4.90E-07 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 1.50E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 6.21E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 1.35E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 3.59E-06 mr1831_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 2.54E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 9.70E-07 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 1.36E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 5.83E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819934549 NA 4.25E-06 mr1985_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251