Variant ID: vg0819861761 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 19861761 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAATAATTAGTCACATATAAATTTATATTCATGTTTTATCGTCTAATAATAATAAAAATAATAATTATAAAAAAATTAAATAAGACGAACGATCAAACGT[C/T]
GAACATGAACGGTCTAAAACTACACTTATTTTGAGGGAGAGTGTCGACAGGGGATACTCGTAGACCAGATATAGAGGGTATTGGGGTACGCTGGTACGAG
CTCGTACCAGCGTACCCCAATACCCTCTATATCTGGTCTACGAGTATCCCCTGTCGACACTCTCCCTCAAAATAAGTGTAGTTTTAGACCGTTCATGTTC[G/A]
ACGTTTGATCGTTCGTCTTATTTAATTTTTTTATAATTATTATTTTTATTATTATTAGACGATAAAACATGAATATAAATTTATATGTGACTAATTATTT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 70.30% | 14.20% | 6.22% | 9.31% | NA |
All Indica | 2759 | 75.30% | 0.40% | 9.50% | 14.86% | NA |
All Japonica | 1512 | 55.60% | 42.50% | 1.79% | 0.13% | NA |
Aus | 269 | 98.50% | 0.40% | 0.00% | 1.12% | NA |
Indica I | 595 | 96.30% | 0.30% | 1.18% | 2.18% | NA |
Indica II | 465 | 85.20% | 0.40% | 4.73% | 9.68% | NA |
Indica III | 913 | 57.60% | 0.10% | 20.04% | 22.23% | NA |
Indica Intermediate | 786 | 74.00% | 0.60% | 6.36% | 18.96% | NA |
Temperate Japonica | 767 | 29.30% | 67.80% | 2.87% | 0.00% | NA |
Tropical Japonica | 504 | 92.50% | 7.30% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 62.20% | 35.30% | 1.66% | 0.83% | NA |
VI/Aromatic | 96 | 78.10% | 1.00% | 1.04% | 19.79% | NA |
Intermediate | 90 | 71.10% | 17.80% | 4.44% | 6.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0819861761 | C -> T | LOC_Os08g32010.1 | upstream_gene_variant ; 2308.0bp to feature; MODIFIER | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
vg0819861761 | C -> T | LOC_Os08g32020.1 | upstream_gene_variant ; 993.0bp to feature; MODIFIER | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
vg0819861761 | C -> T | LOC_Os08g32030.1 | downstream_gene_variant ; 4649.0bp to feature; MODIFIER | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
vg0819861761 | C -> T | LOC_Os08g32010-LOC_Os08g32020 | intergenic_region ; MODIFIER | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
vg0819861761 | C -> DEL | N | N | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0819861761 | NA | 4.05E-11 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | 8.80E-07 | 8.80E-07 | mr1200 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 1.41E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 3.69E-06 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 8.81E-11 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | 6.02E-06 | NA | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 6.72E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 6.85E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 1.72E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0819861761 | NA | 8.48E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/