Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819736179:

Variant ID: vg0819736179 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19736179
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATAACTTTTGACTGAGAATTAGCCTAACACTTTACATGTTTTGTGGCATGCAGGTGATAACATTAGATATGTATTTGAAAATACATGTTAATTTCA[A/G]
TTTCATAGTTGCTATTATGTTGAGGCAGCCAAAGCACTGTGAAAATCTTACCCCTGAGCTCTCGCCCAGCGTGAGAACTGATATAACTGAACGCTTTCGT

Reverse complement sequence

ACGAAAGCGTTCAGTTATATCAGTTCTCACGCTGGGCGAGAGCTCAGGGGTAAGATTTTCACAGTGCTTTGGCTGCCTCAACATAATAGCAACTATGAAA[T/C]
TGAAATTAACATGTATTTTCAAATACATATCTAATGTTATCACCTGCATGCCACAAAACATGTAAAGTGTTAGGCTAATTCTCAGTCAAAAGTTATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	12.70%	3.32%	6.60%	NA
All Indica	2759	73.50%	21.10%	2.14%	3.19%	NA
All Japonica	1512	92.90%	0.30%	3.90%	2.91%	NA
Aus	269	41.60%	0.00%	8.92%	49.44%	NA
Indica I	595	95.60%	2.40%	1.51%	0.50%	NA
Indica II	465	78.10%	14.00%	4.30%	3.66%	NA
Indica III	913	61.10%	34.80%	1.20%	2.85%	NA
Indica Intermediate	786	68.60%	23.70%	2.42%	5.34%	NA
Temperate Japonica	767	96.20%	0.00%	2.35%	1.43%	NA
Tropical Japonica	504	88.30%	0.60%	6.35%	4.76%	NA
Japonica Intermediate	241	91.70%	0.80%	3.73%	3.73%	NA
VI/Aromatic	96	50.00%	2.10%	8.33%	39.58%	NA
Intermediate	90	73.30%	8.90%	7.78%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819736179	A -> G	LOC_Os08g31820.1	upstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31814.1	downstream_gene_variant ; 3577.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31840.1	downstream_gene_variant ; 3452.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31814.2	downstream_gene_variant ; 2904.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31840.2	downstream_gene_variant ; 3452.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31840.3	downstream_gene_variant ; 3452.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31840.4	downstream_gene_variant ; 3452.0bp to feature; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> G	LOC_Os08g31830.1	intron_variant ; MODIFIER	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N
vg0819736179	A -> DEL	N	N	silent_mutation	Average:66.978; most accessible tissue: Callus, score: 79.873	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819736179	NA	4.78E-06	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819736179	NA	4.34E-06	mr1264	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819736179	NA	5.72E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819736179	NA	3.60E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819736179	NA	5.65E-06	mr1673	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819736179	2.39E-06	2.39E-06	mr1762	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251