Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819496937:

Variant ID: vg0819496937 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19496937
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, A: 0.24, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTCTATGGCATTAACTACATTGCCATGTAGGACTTTTAACTTATGTGGCACTATATTAATTAAGAAAGAGAGTGCAAGACACAGCTTCAACACGAGAA[C/A,T]
CTATGCATTAGACACTATCAAGTTTTGCATTGGGAGATAATAGTGTCTTCATGATAGATGAAGAATAAATATGATTGGTAGAGAAGAGAGATGATGTATT

Reverse complement sequence

AATACATCATCTCTCTTCTCTACCAATCATATTTATTCTTCATCTATCATGAAGACACTATTATCTCCCAATGCAAAACTTGATAGTGTCTAATGCATAG[G/T,A]
TTCTCGTGTTGAAGCTGTGTCTTGCACTCTCTTTCTTAATTAATATAGTGCCACATAAGTTAAAAGTCCTACATGGCAATGTAGTTAATGCCATAGACAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 35.90% 0.06% 0.00% T: 0.21%
All Indica  2759 95.20% 4.70% 0.04% 0.00% T: 0.04%
All Japonica  1512 17.90% 81.90% 0.07% 0.00% T: 0.07%
Aus  269 25.30% 73.60% 0.00% 0.00% T: 1.12%
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 8.10% 0.00% 0.00% T: 0.13%
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 46.60% 53.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 86.70% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 5.20% 90.60% 1.04% 0.00% T: 3.12%
Intermediate  90 50.00% 47.80% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819496937 C -> T LOC_Os08g31520.1 upstream_gene_variant ; 3845.0bp to feature; MODIFIER silent_mutation Average:97.994; most accessible tissue: Zhenshan97 panicle, score: 98.942 N N N N
vg0819496937 C -> T LOC_Os08g31520-LOC_Os08g31540 intergenic_region ; MODIFIER silent_mutation Average:97.994; most accessible tissue: Zhenshan97 panicle, score: 98.942 N N N N
vg0819496937 C -> A LOC_Os08g31520.1 upstream_gene_variant ; 3845.0bp to feature; MODIFIER silent_mutation Average:97.994; most accessible tissue: Zhenshan97 panicle, score: 98.942 N N N N
vg0819496937 C -> A LOC_Os08g31520-LOC_Os08g31540 intergenic_region ; MODIFIER silent_mutation Average:97.994; most accessible tissue: Zhenshan97 panicle, score: 98.942 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819496937 C A -0.11 -0.13 -0.06 -0.09 -0.08 -0.07
vg0819496937 C T -0.1 -0.1 -0.05 -0.08 -0.07 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819496937 NA 3.78E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 2.57E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 5.26E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 5.88E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 1.87E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 2.31E-25 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 2.02E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 7.52E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 1.95E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 9.00E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 3.54E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 1.06E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 6.45E-08 NA mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 1.80E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 4.69E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 4.40E-06 mr1890 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819496937 NA 1.74E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251