| Variant ID: vg0819470898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19470898 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )
TGTTGCTACAACCAGCCTACAGGTACTTCCTTTATATTGTATTTTAAGTTTAAAATAAAACCATAATGAGTACAGAAAGAAAATGATTTCACAATTCAAT[G/C]
AAGGGCCTGTTCATTTTGATGCTAAAAAAAACCTTACCAAATTTTGGCATTGCCGAAATTTTGGCATAATTGCCAAAATTTTGGCAATTTTGGTAGGATT
AATCCTACCAAAATTGCCAAAATTTTGGCAATTATGCCAAAATTTCGGCAATGCCAAAATTTGGTAAGGTTTTTTTTAGCATCAAAATGAACAGGCCCTT[C/G]
ATTGAATTGTGAAATCATTTTCTTTCTGTACTCATTATGGTTTTATTTTAAACTTAAAATACAATATAAAGGAAGTACCTGTAGGCTGGTTGTAGCAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 28.90% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 66.00% | 33.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 83.30% | 16.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 43.90% | 56.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 46.70% | 52.90% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 56.20% | 43.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 55.40% | 44.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819470898 | G -> C | LOC_Os08g31470.1 | downstream_gene_variant ; 1551.0bp to feature; MODIFIER | silent_mutation | Average:42.98; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0819470898 | G -> C | LOC_Os08g31480.1 | downstream_gene_variant ; 1054.0bp to feature; MODIFIER | silent_mutation | Average:42.98; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0819470898 | G -> C | LOC_Os08g31470.4 | downstream_gene_variant ; 1551.0bp to feature; MODIFIER | silent_mutation | Average:42.98; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0819470898 | G -> C | LOC_Os08g31470.2 | downstream_gene_variant ; 1551.0bp to feature; MODIFIER | silent_mutation | Average:42.98; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0819470898 | G -> C | LOC_Os08g31470.3 | downstream_gene_variant ; 1551.0bp to feature; MODIFIER | silent_mutation | Average:42.98; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0819470898 | G -> C | LOC_Os08g31470-LOC_Os08g31480 | intergenic_region ; MODIFIER | silent_mutation | Average:42.98; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819470898 | NA | 2.01E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | 9.18E-06 | 9.18E-06 | mr1413 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | 7.79E-07 | NA | mr1552 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 5.76E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 3.73E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 4.67E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 4.69E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 3.69E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 9.69E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 2.76E-06 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819470898 | NA | 9.95E-08 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |