| Variant ID: vg0819304010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19304010 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTGCTCCTCAGTTTTCTAATTTTGCTTGCTCCAATCAAGTAAGTTTTTTCCAACAAGTTTTCTGTGTTTAAAGTTATAATATGTACCCGTTATGAACT[A/G]
TATAGTAGTGATAGTAAATATAGCTATAGTAAACATTATTTATGGTTTGAGTATCTTCAGCAATCCATGAATTGCGTGAGATATTTAAACATCTTTCTAT
ATAGAAAGATGTTTAAATATCTCACGCAATTCATGGATTGCTGAAGATACTCAAACCATAAATAATGTTTACTATAGCTATATTTACTATCACTACTATA[T/C]
AGTTCATAACGGGTACATATTATAACTTTAAACACAGAAAACTTGTTGGAAAAAACTTACTTGATTGGAGCAAGCAAAATTAGAAAACTGAGGAGCAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.80% | 33.00% | 12.99% | 1.16% | NA |
| All Indica | 2759 | 81.30% | 4.40% | 13.23% | 1.01% | NA |
| All Japonica | 1512 | 13.70% | 72.80% | 11.71% | 1.79% | NA |
| Aus | 269 | 2.60% | 90.00% | 7.43% | 0.00% | NA |
| Indica I | 595 | 83.40% | 1.70% | 13.95% | 1.01% | NA |
| Indica II | 465 | 82.40% | 4.30% | 10.54% | 2.80% | NA |
| Indica III | 913 | 79.80% | 2.50% | 16.87% | 0.77% | NA |
| Indica Intermediate | 786 | 80.90% | 8.80% | 10.05% | 0.25% | NA |
| Temperate Japonica | 767 | 1.00% | 76.40% | 19.04% | 3.52% | NA |
| Tropical Japonica | 504 | 35.10% | 63.70% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 9.10% | 80.50% | 10.37% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 50.00% | 44.79% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 52.20% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819304010 | A -> G | LOC_Os08g31219.1 | upstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:21.359; most accessible tissue: Callus, score: 40.293 | N | N | N | N |
| vg0819304010 | A -> G | LOC_Os08g31228.1 | upstream_gene_variant ; 3312.0bp to feature; MODIFIER | silent_mutation | Average:21.359; most accessible tissue: Callus, score: 40.293 | N | N | N | N |
| vg0819304010 | A -> G | LOC_Os08g31210.1 | downstream_gene_variant ; 2327.0bp to feature; MODIFIER | silent_mutation | Average:21.359; most accessible tissue: Callus, score: 40.293 | N | N | N | N |
| vg0819304010 | A -> G | LOC_Os08g31210-LOC_Os08g31219 | intergenic_region ; MODIFIER | silent_mutation | Average:21.359; most accessible tissue: Callus, score: 40.293 | N | N | N | N |
| vg0819304010 | A -> DEL | N | N | silent_mutation | Average:21.359; most accessible tissue: Callus, score: 40.293 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819304010 | NA | 4.91E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819304010 | NA | 1.62E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819304010 | 2.16E-06 | 1.02E-17 | mr1352_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |