Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819258148:

Variant ID: vg0819258148 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19258148
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAAAAGCAACGGTTAAATTGACAGGGCCCGGAACCTCCTGGTGATGAACACCGGAACTTCCTAGCAGTGATGAGCAGCCCGGAACTTCCGGAGTTCTT[C/G]
AGACAGGAACTTCCGGGCAACAGAGAAAAACGAAATATGAGAAGTATAACAGGTCCTAGCTAGTGAAAATCAGGCACAGGGTTGCACAAGATGAAAATCA

Reverse complement sequence

TGATTTTCATCTTGTGCAACCCTGTGCCTGATTTTCACTAGCTAGGACCTGTTATACTTCTCATATTTCGTTTTTCTCTGTTGCCCGGAAGTTCCTGTCT[G/C]
AAGAACTCCGGAAGTTCCGGGCTGCTCATCACTGCTAGGAAGTTCCGGTGTTCATCACCAGGAGGTTCCGGGCCCTGTCAATTTAACCGTTGCTTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 26.40% 0.42% 5.21% NA
All Indica  2759 97.10% 1.70% 0.58% 0.58% NA
All Japonica  1512 14.10% 72.90% 0.13% 12.90% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 97.50% 1.80% 0.34% 0.34% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 95.10% 2.30% 1.20% 1.42% NA
Indica Intermediate  786 98.10% 1.50% 0.25% 0.13% NA
Temperate Japonica  767 0.90% 77.10% 0.13% 21.90% NA
Tropical Japonica  504 36.30% 63.30% 0.20% 0.20% NA
Japonica Intermediate  241 9.50% 79.70% 0.00% 10.79% NA
VI/Aromatic  96 11.50% 52.10% 0.00% 36.46% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819258148 C -> G LOC_Os08g31150.1 upstream_gene_variant ; 968.0bp to feature; MODIFIER silent_mutation Average:30.874; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0819258148 C -> G LOC_Os08g31160.1 upstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:30.874; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0819258148 C -> G LOC_Os08g31160-LOC_Os08g31170 intergenic_region ; MODIFIER silent_mutation Average:30.874; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0819258148 C -> DEL N N silent_mutation Average:30.874; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819258148 5.01E-06 NA mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 6.75E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 7.29E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 8.07E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 4.10E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 4.83E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 9.48E-25 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.51E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 5.87E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.40E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 9.74E-07 NA mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 3.14E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 6.49E-12 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.03E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.88E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.59E-17 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 8.19E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.64E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 7.86E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.29E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 3.41E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.59E-17 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.99E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 4.43E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.47E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 3.87E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 7.02E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.13E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 6.11E-39 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.59E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 6.12E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.80E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.79E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 6.53E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 5.94E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 5.36E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 6.07E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 3.80E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 4.40E-06 NA mr1820 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.34E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 5.38E-23 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 5.66E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 2.36E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.31E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 1.30E-30 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258148 NA 4.01E-14 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251