Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819131129:

Variant ID: vg0819131129 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19131129
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCAATATAATCATATTGCGCCACAAACACAACCTATTAGGCCACCAAATCCACTGCCAAATCAACATAGGCCTGATAATATGAAGGAAATAATTAGTGA[G/T]
ATTATTAGGGATAAATTCGGGATTGAAACTAGGAATCGTGCCAGGGTTTACAAAAAGCTGTATCCTGACTATTATGATAATGTGCCGTTTCCCCGTAATT

Reverse complement sequence

AATTACGGGGAAACGGCACATTATCATAATAGTCAGGATACAGCTTTTTGTAAACCCTGGCACGATTCCTAGTTTCAATCCCGAATTTATCCCTAATAAT[C/A]
TCACTAATTATTTCCTTCATATTATCAGGCCTATGTTGATTTGGCAGTGGATTTGGTGGCCTAATAGGTTGTGTTTGTGGCGCAATATGATTATATTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.50% 0.47% 0.00% NA
All Indica  2759 94.10% 5.30% 0.69% 0.00% NA
All Japonica  1512 13.10% 86.80% 0.13% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 97.30% 2.40% 0.34% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 92.30% 6.40% 1.31% 0.00% NA
Indica Intermediate  786 92.10% 7.40% 0.51% 0.00% NA
Temperate Japonica  767 0.80% 99.10% 0.13% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.20% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819131129 G -> T LOC_Os08g30990.1 missense_variant ; p.Glu208Asp; MODERATE nonsynonymous_codon ; E208D Average:42.828; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819131129 NA 4.72E-07 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 3.37E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 2.33E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 6.55E-09 6.55E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 5.92E-06 5.91E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 2.36E-06 NA mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 5.07E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 3.14E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 5.56E-06 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 3.81E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 2.30E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 4.25E-24 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 1.46E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 1.91E-06 8.74E-09 mr1622 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 6.29E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 2.25E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 1.16E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 9.35E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 8.38E-06 8.37E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 5.10E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 6.23E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 9.91E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 4.21E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131129 NA 3.86E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251