Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818818092:

Variant ID: vg0818818092 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18818092
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GAGATGGATAAGATTGAAGGAGGGTATTTTGGTTAGTTTGAATAATAAATAGATTTATTTTCTTTTTCCTAAATGAAACCCTATCAGTATATTGCAAATA[T/G]
AGTCAAACGGTAGGTTCAATTGTGAAAAGCAGGGTTAAATCAGCAACCTAGAAAAAAATAAGATCCGATTGGTAGTTAGCCTTCGAAATAGGGTCAAATA

Reverse complement sequence

TATTTGACCCTATTTCGAAGGCTAACTACCAATCGGATCTTATTTTTTTCTAGGTTGCTGATTTAACCCTGCTTTTCACAATTGAACCTACCGTTTGACT[A/C]
TATTTGCAATATACTGATAGGGTTTCATTTAGGAAAAAGAAAATAAATCTATTTATTATTCAAACTAACCAAAATACCCTCCTTCAATCTTATCCATCTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	13.10%	0.17%	2.69%	NA
All Indica	2759	79.20%	15.90%	0.29%	4.60%	NA
All Japonica	1512	88.60%	11.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.10%	4.70%	0.00%	0.17%	NA
Indica II	465	92.70%	6.50%	0.00%	0.86%	NA
Indica III	913	68.70%	20.60%	0.33%	10.41%	NA
Indica Intermediate	786	71.20%	24.70%	0.64%	3.44%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	68.50%	31.50%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818818092	T -> G	LOC_Os08g30554.1	upstream_gene_variant ; 3173.0bp to feature; MODIFIER	silent_mutation	Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg0818818092	T -> G	LOC_Os08g30550.1	downstream_gene_variant ; 3477.0bp to feature; MODIFIER	silent_mutation	Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg0818818092	T -> G	LOC_Os08g30550-LOC_Os08g30554	intergenic_region ; MODIFIER	silent_mutation	Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg0818818092	T -> DEL	N	N	silent_mutation	Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818818092	NA	5.31E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	1.22E-09	1.22E-09	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	9.33E-06	9.32E-06	mr1299	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	6.82E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	8.43E-06	1.23E-07	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	3.10E-06	mr1352	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	2.61E-07	2.24E-06	mr1358	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	9.43E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	2.86E-07	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	4.73E-06	4.73E-06	mr1756	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	1.80E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	2.96E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	5.49E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	1.81E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092	NA	2.18E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251