Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818727476:

Variant ID: vg0818727476 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18727476
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTTATTGCACAACTATATCCTGTTCACTATAATATTTGTTATTAAATTGATATGGTTTACTAAATAAAAGAGAGATCAATTGTCAATCATTTCTACTA[C/G,T]
TAGTAAACACCACCATAAAAGTATAGTAGGCAGGAAGTAAAAGCAGCTATTGTATTTTACTGACAATTCTTAATGCATCTATGTAGTTCTCCTGTATATC

Reverse complement sequence

GATATACAGGAGAACTACATAGATGCATTAAGAATTGTCAGTAAAATACAATAGCTGCTTTTACTTCCTGCCTACTATACTTTTATGGTGGTGTTTACTA[G/C,A]
TAGTAGAAATGATTGACAATTGATCTCTCTTTTATTTAGTAAACCATATCAATTTAATAACAAATATTATAGTGAACAGGATATAGTTGTGCAATAAAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	15.80%	0.04%	0.00%	T: 0.06%
All Indica	2759	79.20%	20.70%	0.07%	0.00%	T: 0.04%
All Japonica	1512	88.60%	11.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.00%	5.00%	0.00%	0.00%	NA
Indica II	465	92.70%	7.30%	0.00%	0.00%	NA
Indica III	913	68.10%	31.80%	0.11%	0.00%	NA
Indica Intermediate	786	72.30%	27.50%	0.13%	0.00%	T: 0.13%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	68.70%	31.30%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	0.00%	0.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818727476	C -> G	LOC_Os08g30430.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:43.916; most accessible tissue: Callus, score: 64.749	N	N	N	N
vg0818727476	C -> G	LOC_Os08g30420-LOC_Os08g30430	intergenic_region ; MODIFIER	silent_mutation	Average:43.916; most accessible tissue: Callus, score: 64.749	N	N	N	N
vg0818727476	C -> T	LOC_Os08g30430.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:43.916; most accessible tissue: Callus, score: 64.749	N	N	N	N
vg0818727476	C -> T	LOC_Os08g30420-LOC_Os08g30430	intergenic_region ; MODIFIER	silent_mutation	Average:43.916; most accessible tissue: Callus, score: 64.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818727476	NA	4.85E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	NA	9.37E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	2.58E-06	1.30E-06	mr1266	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	1.15E-09	1.14E-09	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	NA	3.84E-07	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	NA	5.61E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	NA	3.66E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	NA	2.12E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476	NA	5.69E-09	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251