Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818674921:

Variant ID: vg0818674921 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18674921
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCATAAACTTTATGGGAACTTTCTTCTTGGTAAATCTCTCAATCTCTTATAAAGAAACATGCGCATGGATTTGGTCTCTGTTGTTCTCACTTCTCAG[T/A]
ATGTTCGCTTTTGTGATCATATCATGCACAAATTATCCTGCTTTCCAGTTAGTTGAAGCCACTTTTTTAACACTTCACACATTACTTAGATGAACAGTGT

Reverse complement sequence

ACACTGTTCATCTAAGTAATGTGTGAAGTGTTAAAAAAGTGGCTTCAACTAACTGGAAAGCAGGATAATTTGTGCATGATATGATCACAAAAGCGAACAT[A/T]
CTGAGAAGTGAGAACAACAGAGACCAAATCCATGCGCATGTTTCTTTATAAGAGATTGAGAGATTTACCAAGAAGAAAGTTCCCATAAAGTTTATGCACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	1.30%	2.71%	1.40%	NA
All Indica	2759	97.10%	0.40%	1.67%	0.83%	NA
All Japonica	1512	88.80%	3.20%	5.29%	2.78%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	91.90%	1.00%	4.71%	2.41%	NA
Indica Intermediate	786	99.10%	0.40%	0.38%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	69.20%	8.10%	14.48%	8.13%	NA
Japonica Intermediate	241	93.80%	2.90%	2.90%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	97.80%	0.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818674921	T -> A	LOC_Os08g30330.1	upstream_gene_variant ; 4988.0bp to feature; MODIFIER	silent_mutation	Average:45.535; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0818674921	T -> A	LOC_Os08g30340.1	upstream_gene_variant ; 1080.0bp to feature; MODIFIER	silent_mutation	Average:45.535; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0818674921	T -> A	LOC_Os08g30340.2	upstream_gene_variant ; 1063.0bp to feature; MODIFIER	silent_mutation	Average:45.535; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0818674921	T -> A	LOC_Os08g30330-LOC_Os08g30340	intergenic_region ; MODIFIER	silent_mutation	Average:45.535; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0818674921	T -> DEL	N	N	silent_mutation	Average:45.535; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818674921	NA	2.90E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	2.57E-08	2.57E-08	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	3.95E-06	8.05E-08	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	NA	3.35E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	NA	1.01E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	1.15E-08	1.15E-08	mr1873	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	NA	4.00E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818674921	NA	4.75E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251