Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818544432:

Variant ID: vg0818544432 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18544432
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAAGGTAAGAAAACCTGGACCAAAGTGAAAACGTTAGATATAACCTAGTCCAAAATAAAACTCAGGCAATAATAACCGGCCCAAAGTGCAATTCACT[C/T]
AATAATAAATTATAATTATGTAAAATATTTTAATAAGACGAATAGTGAAATATTTGCTTTCGGCCTTATGCATGATGACGTAGCGGTGACAACGACATCA

Reverse complement sequence

TGATGTCGTTGTCACCGCTACGTCATCATGCATAAGGCCGAAAGCAAATATTTCACTATTCGTCTTATTAAAATATTTTACATAATTATAATTTATTATT[G/A]
AGTGAATTGCACTTTGGGCCGGTTATTATTGCCTGAGTTTTATTTTGGACTAGGTTATATCTAACGTTTTCACTTTGGTCCAGGTTTTCTTACCTTCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 44.90% 0.19% 0.02% NA
All Indica  2759 31.10% 68.60% 0.25% 0.04% NA
All Japonica  1512 87.40% 12.60% 0.00% 0.00% NA
Aus  269 95.50% 4.10% 0.37% 0.00% NA
Indica I  595 30.30% 69.10% 0.67% 0.00% NA
Indica II  465 82.60% 17.20% 0.00% 0.22% NA
Indica III  913 2.70% 97.00% 0.22% 0.00% NA
Indica Intermediate  786 34.10% 65.80% 0.13% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 67.70% 32.30% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818544432 C -> T LOC_Os08g30140.1 upstream_gene_variant ; 4247.0bp to feature; MODIFIER silent_mutation Average:93.431; most accessible tissue: Minghui63 root, score: 99.154 N N N N
vg0818544432 C -> T LOC_Os08g30150.1 upstream_gene_variant ; 846.0bp to feature; MODIFIER silent_mutation Average:93.431; most accessible tissue: Minghui63 root, score: 99.154 N N N N
vg0818544432 C -> T LOC_Os08g30160.1 upstream_gene_variant ; 2014.0bp to feature; MODIFIER silent_mutation Average:93.431; most accessible tissue: Minghui63 root, score: 99.154 N N N N
vg0818544432 C -> T LOC_Os08g30170.1 downstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:93.431; most accessible tissue: Minghui63 root, score: 99.154 N N N N
vg0818544432 C -> T LOC_Os08g30150-LOC_Os08g30160 intergenic_region ; MODIFIER silent_mutation Average:93.431; most accessible tissue: Minghui63 root, score: 99.154 N N N N
vg0818544432 C -> DEL N N silent_mutation Average:93.431; most accessible tissue: Minghui63 root, score: 99.154 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818544432 C T -0.06 -0.06 -0.03 0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818544432 NA 2.86E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818544432 NA 1.37E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 1.19E-06 1.19E-06 mr1058 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 4.74E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.01E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 4.20E-09 4.20E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 5.47E-07 5.47E-07 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 5.61E-07 1.29E-08 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 2.20E-06 NA mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 7.44E-07 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 3.33E-06 3.33E-06 mr1417 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 1.20E-06 2.62E-07 mr1427 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.05E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 9.30E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 6.56E-07 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 4.83E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.88E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 3.95E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 3.30E-06 3.30E-06 mr1756 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.65E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 3.65E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 4.96E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 2.75E-07 2.75E-07 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 6.73E-06 6.74E-06 mr1948 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.66E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 4.89E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 5.58E-10 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 2.13E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 5.23E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 5.79E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.19E-12 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 2.79E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 2.58E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 7.34E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 3.55E-11 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 1.76E-11 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 2.15E-13 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 2.23E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818544432 NA 2.47E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251