Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818318988:

Variant ID: vg0818318988 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18318988
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTCTTTTTCTAAAAGGCTGTAGACCTGTGTATATCACGTACTTTTTTTTAGAAATAATACGTGCACACTTTATCTCTATAAATGCATCTGGACACCCT[G/A]
TTACGAGCACTTTCGAAACACTAAAAGACTAGATCGACATATTTTTTTTGAGATTAACGAAGTTACTACGGGCGCTTCATTTGAAAATGTTAGCTACAAA

Reverse complement sequence

TTTGTAGCTAACATTTTCAAATGAAGCGCCCGTAGTAACTTCGTTAATCTCAAAAAAAATATGTCGATCTAGTCTTTTAGTGTTTCGAAAGTGCTCGTAA[C/T]
AGGGTGTCCAGATGCATTTATAGAGATAAAGTGTGCACGTATTATTTCTAAAAAAAAGTACGTGATATACACAGGTCTACAGCCTTTTAGAAAAAGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	5.70%	0.66%	7.60%	NA
All Indica	2759	89.20%	4.00%	0.14%	6.74%	NA
All Japonica	1512	85.30%	2.20%	1.46%	10.98%	NA
Aus	269	56.10%	41.30%	1.49%	1.12%	NA
Indica I	595	76.50%	0.20%	0.50%	22.86%	NA
Indica II	465	92.90%	4.30%	0.00%	2.80%	NA
Indica III	913	93.90%	5.80%	0.00%	0.33%	NA
Indica Intermediate	786	91.10%	4.50%	0.13%	4.33%	NA
Temperate Japonica	767	98.20%	0.80%	0.39%	0.65%	NA
Tropical Japonica	504	72.00%	0.60%	3.17%	24.21%	NA
Japonica Intermediate	241	72.20%	10.40%	1.24%	16.18%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	86.70%	7.80%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818318988	G -> A	LOC_Os08g29790.1	upstream_gene_variant ; 4934.0bp to feature; MODIFIER	silent_mutation	Average:42.624; most accessible tissue: Minghui63 flower, score: 59.225	N	N	N	N
vg0818318988	G -> A	LOC_Os08g29809.1	downstream_gene_variant ; 101.0bp to feature; MODIFIER	silent_mutation	Average:42.624; most accessible tissue: Minghui63 flower, score: 59.225	N	N	N	N
vg0818318988	G -> A	LOC_Os08g29790-LOC_Os08g29809	intergenic_region ; MODIFIER	silent_mutation	Average:42.624; most accessible tissue: Minghui63 flower, score: 59.225	N	N	N	N
vg0818318988	G -> DEL	N	N	silent_mutation	Average:42.624; most accessible tissue: Minghui63 flower, score: 59.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818318988	2.14E-06	3.69E-07	mr1040	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818318988	2.86E-06	1.06E-09	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251