Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818260770:

Variant ID: vg0818260770 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18260770
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTAAACAAGCCAAGCTCAAGTCTAGGCTGAGGCTCGCAAGCCTAGTAAGTTCGAACTCGAATAGCTCGGCAAGGCTTGATTAGTATAAGATGCATTG[C/T]
ATTTAGGAAGATATTCTTAATGGATCAATATATACTTGTCATCGTGCTTGATCTGTTTAAGTCTTAAGAACTCATCAATGCTTCTCAATAAAGCAATTAT

Reverse complement sequence

ATAATTGCTTTATTGAGAAGCATTGATGAGTTCTTAAGACTTAAACAGATCAAGCACGATGACAAGTATATATTGATCCATTAAGAATATCTTCCTAAAT[G/A]
CAATGCATCTTATACTAATCAAGCCTTGCCGAGCTATTCGAGTTCGAACTTACTAGGCTTGCGAGCCTCAGCCTAGACTTGAGCTTGGCTTGTTTAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.30%	19.70%	0.00%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	63.20%	36.80%	0.00%	0.00%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	88.60%	11.40%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	90.10%	9.90%	0.00%	0.00%	NA
Temperate Japonica	767	81.60%	18.40%	0.00%	0.00%	NA
Tropical Japonica	504	40.70%	59.30%	0.00%	0.00%	NA
Japonica Intermediate	241	51.50%	48.50%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818260770	C -> T	LOC_Os08g29730.1	upstream_gene_variant ; 4877.0bp to feature; MODIFIER	silent_mutation	Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0818260770	C -> T	LOC_Os08g29720.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0818260770	C -> T	LOC_Os08g29720.2	downstream_gene_variant ; 3205.0bp to feature; MODIFIER	silent_mutation	Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0818260770	C -> T	LOC_Os08g29720-LOC_Os08g29730	intergenic_region ; MODIFIER	silent_mutation	Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818260770	5.31E-07	NA	Grain_width	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818260770	NA	6.59E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770	NA	1.08E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770	NA	2.13E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770	NA	9.30E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770	NA	1.15E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251