Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818092386:

Variant ID: vg0818092386 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18092386
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTCTATATTCATTAACATATATTCATTAACATCTATATGAATGTGGGAAATGCTAGAATAACTTATATTGTGAAACAGAGGTAGTAGTAAGCAACTATT[G/A]
TATGAATTATTAACATCAATATGAATGTGAAAAATACTAGAATAACTTACATTGTGAAACGGAGGAAGTAATAAGCAACTATTGTATGAATTGGCTATTA

Reverse complement sequence

TAATAGCCAATTCATACAATAGTTGCTTATTACTTCCTCCGTTTCACAATGTAAGTTATTCTAGTATTTTTCACATTCATATTGATGTTAATAATTCATA[C/T]
AATAGTTGCTTACTACTACCTCTGTTTCACAATATAAGTTATTCTAGCATTTCCCACATTCATATAGATGTTAATGAATATATGTTAATGAATATAGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	10.20%	0.02%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	75.70%	24.30%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	88.00%	12.00%	0.00%	0.00%	NA
Tropical Japonica	504	59.30%	40.50%	0.20%	0.00%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818092386	G -> A	LOC_Os08g29500.2	downstream_gene_variant ; 379.0bp to feature; MODIFIER	silent_mutation	Average:63.278; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0818092386	G -> A	LOC_Os08g29510.1	downstream_gene_variant ; 1016.0bp to feature; MODIFIER	silent_mutation	Average:63.278; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0818092386	G -> A	LOC_Os08g29500.1	downstream_gene_variant ; 379.0bp to feature; MODIFIER	silent_mutation	Average:63.278; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0818092386	G -> A	LOC_Os08g29500-LOC_Os08g29510	intergenic_region ; MODIFIER	silent_mutation	Average:63.278; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818092386	4.18E-06	NA	mr1836_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818092386	NA	1.75E-06	mr1836_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251