Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818053416:

Variant ID: vg0818053416 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18053416
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATTATTTAATGATGGCTTAATGTTAGCTCACGATGGTCAATCGTGATTGGTTAATTAATTAAATTGCCAACTAAAACCTGATAATGGTGGGTTGTGAG[C/T]
ACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACGGGTTCACGATTTTCGGTTGTGAAACATTTACCGTGCCAACCACAAGCCAGCGTGGGCAACG

Reverse complement sequence

CGTTGCCCACGCTGGCTTGTGGTTGGCACGGTAAATGTTTCACAACCGAAAATCGTGAACCCGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGT[G/A]
CTCACAACCCACCATTATCAGGTTTTAGTTGGCAATTTAATTAATTAACCAATCACGATTGACCATCGTGAGCTAACATTAAGCCATCATTAAATAATAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	4.10%	1.57%	5.44%	NA
All Indica	2759	90.90%	0.40%	0.72%	7.97%	NA
All Japonica	1512	83.60%	11.40%	3.04%	1.98%	NA
Aus	269	94.10%	1.90%	2.97%	1.12%	NA
Indica I	595	93.90%	0.00%	2.02%	4.03%	NA
Indica II	465	98.50%	0.20%	0.43%	0.86%	NA
Indica III	913	87.60%	0.80%	0.33%	11.28%	NA
Indica Intermediate	786	87.90%	0.40%	0.38%	11.32%	NA
Temperate Japonica	767	98.00%	1.00%	0.65%	0.26%	NA
Tropical Japonica	504	62.90%	25.40%	6.35%	5.36%	NA
Japonica Intermediate	241	80.90%	14.90%	3.73%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	92.20%	4.40%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818053416	C -> T	LOC_Os08g29460.1	upstream_gene_variant ; 3469.0bp to feature; MODIFIER	silent_mutation	Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566	N	N	N	N
vg0818053416	C -> T	LOC_Os08g29440.1	downstream_gene_variant ; 3437.0bp to feature; MODIFIER	silent_mutation	Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566	N	N	N	N
vg0818053416	C -> T	LOC_Os08g29450.1	downstream_gene_variant ; 1117.0bp to feature; MODIFIER	silent_mutation	Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566	N	N	N	N
vg0818053416	C -> T	LOC_Os08g29440-LOC_Os08g29450	intergenic_region ; MODIFIER	silent_mutation	Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566	N	N	N	N
vg0818053416	C -> DEL	N	N	silent_mutation	Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818053416	NA	5.23E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416	NA	3.72E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416	NA	7.47E-06	mr1836	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416	NA	8.47E-08	mr1277_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416	NA	1.99E-06	mr1362_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416	NA	2.05E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251