Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817690102:

Variant ID: vg0817690102 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17690102
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACAAAACCAGATATTTTACACCCTCAAGTATTCATACCGGACAAATAACCCCTTTGAGCATTGTTCATAGCGGTTTAGAGTTGAGCTTGTACACGTGGC[G/A,T]
CCAACGTGGAATCTAGTCAGCAAATAAAATAAAAAAAAATTCCCTGGGCCCACAAGTCATACATATTCCTCAATCAAATCCCTCCAAGTCCCCCTTGTGC

Reverse complement sequence

GCACAAGGGGGACTTGGAGGGATTTGATTGAGGAATATGTATGACTTGTGGGCCCAGGGAATTTTTTTTTATTTTATTTGCTGACTAGATTCCACGTTGG[C/T,A]
GCCACGTGTACAAGCTCAACTCTAAACCGCTATGAACAATGCTCAAAGGGGTTATTTGTCCGGTATGAATACTTGAGGGTGTAAAATATCTGGTTTTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 5.60% 0.06% 0.00% T: 0.44%
All Indica  2759 98.70% 1.30% 0.00% 0.00% T: 0.04%
All Japonica  1512 83.70% 14.90% 0.20% 0.00% T: 1.26%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.00% 0.00% T: 0.11%
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 61.50% 34.30% 0.60% 0.00% T: 3.57%
Japonica Intermediate  241 82.20% 17.40% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817690102 G -> T LOC_Os08g28920.1 upstream_gene_variant ; 4815.0bp to feature; MODIFIER silent_mutation Average:77.394; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0817690102 G -> T LOC_Os08g28930.1 intron_variant ; MODIFIER silent_mutation Average:77.394; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0817690102 G -> A LOC_Os08g28920.1 upstream_gene_variant ; 4815.0bp to feature; MODIFIER silent_mutation Average:77.394; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0817690102 G -> A LOC_Os08g28930.1 intron_variant ; MODIFIER silent_mutation Average:77.394; most accessible tissue: Minghui63 flower, score: 95.53 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817690102 G A 0.0 -0.01 -0.01 0.0 0.0 0.0
vg0817690102 G T -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817690102 NA 5.51E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 9.15E-06 1.26E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 7.43E-06 NA mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 2.38E-06 3.18E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 7.29E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 4.53E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 1.08E-07 NA mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 2.24E-06 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 1.33E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 5.78E-06 NA mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 3.84E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 4.62E-06 8.45E-20 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 2.61E-07 NA mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 1.63E-07 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 6.23E-06 4.01E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 4.21E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 4.34E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 2.50E-09 NA mr1836_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 8.34E-08 8.95E-08 mr1836_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 4.14E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817690102 NA 3.58E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251