Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817662622:

Variant ID: vg0817662622 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17662622
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACATGTAACAAAGATAAAGGAGTATATATATACATGAAAACTATGAGTATTAAGATAACTTCTTGGATTCTAACCCAACATTTTACCTTTTCATTTAAA[T/A]
CTGAGATAAATAGAGACTATAAATAGAAATAACATATTTGAAAAATCTAAATATGTAATAGGTCTCCTTCCTCCGTTCAAAAATATATGCATTTTTAGCA

Reverse complement sequence

TGCTAAAAATGCATATATTTTTGAACGGAGGAAGGAGACCTATTACATATTTAGATTTTTCAAATATGTTATTTCTATTTATAGTCTCTATTTATCTCAG[A/T]
TTTAAATGAAAAGGTAAAATGTTGGGTTAGAATCCAAGAAGTTATCTTAATACTCATAGTTTTCATGTATATATATACTCCTTTATCTTTGTTACATGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.50% 0.00% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 85.20% 14.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 65.70% 34.30% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817662622 T -> A LOC_Os08g28880.1 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:46.796; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0817662622 T -> A LOC_Os08g28870-LOC_Os08g28880 intergenic_region ; MODIFIER silent_mutation Average:46.796; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817662622 NA 1.23E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 8.37E-07 2.63E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 4.19E-06 NA mr1362 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 1.44E-07 6.01E-18 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 1.44E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 2.78E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 1.36E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 1.88E-08 NA mr1836 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 6.73E-07 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 8.44E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 2.30E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 2.07E-06 NA mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 4.11E-06 1.99E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 1.96E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 1.52E-06 3.21E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 4.59E-08 NA mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 3.12E-06 3.72E-08 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 4.95E-07 9.29E-18 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 1.93E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 2.32E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 4.62E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 7.61E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 3.36E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 2.36E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 4.44E-08 NA mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 3.97E-06 4.23E-07 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 5.23E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817662622 NA 1.45E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251