Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817334525:

Variant ID: vg0817334525 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17334525
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.20, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGCGCTCCTGATCATCACGCCTAATCCTCTGGCCGAACTCACAAAGGGGGGGTCTCACGTCCTCCCGCTAGAGATGGTCACTCCTCGACAGCTGGCG[C/T]
GCAAGGTAGGGGAAATCCCGCGCGTTTGTGAAGGAGCCGTTTTTCTTCCGCCCCAAGTTTCCTTCCATCCTCAACGACCATGGTCGAGGTAGTGGAGGAA

Reverse complement sequence

TTCCTCCACTACCTCGACCATGGTCGTTGAGGATGGAAGGAAACTTGGGGCGGAAGAAAAACGGCTCCTTCACAAACGCGCGGGATTTCCCCTACCTTGC[G/A]
CGCCAGCTGTCGAGGAGTGACCATCTCTAGCGGGAGGACGTGAGACCCCCCCTTTGTGAGTTCGGCCAGAGGATTAGGCGTGATGATCAGGAGCGCTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.10% 0.19% 0.36% NA
All Indica  2759 39.00% 60.20% 0.22% 0.58% NA
All Japonica  1512 96.90% 2.90% 0.20% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 45.50% 53.80% 0.17% 0.50% NA
Indica II  465 14.60% 84.90% 0.00% 0.43% NA
Indica III  913 39.90% 59.40% 0.44% 0.33% NA
Indica Intermediate  786 47.50% 51.40% 0.13% 1.02% NA
Temperate Japonica  767 95.30% 4.60% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817334525 C -> T LOC_Os08g28410.1 downstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:72.643; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg0817334525 C -> T LOC_Os08g28400-LOC_Os08g28410 intergenic_region ; MODIFIER silent_mutation Average:72.643; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg0817334525 C -> DEL N N silent_mutation Average:72.643; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817334525 C T 0.0 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817334525 2.80E-06 2.80E-06 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817334525 NA 2.56E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817334525 2.70E-06 2.70E-06 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817334525 9.67E-06 2.19E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817334525 NA 3.59E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251