RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0817313550:

Variant ID: vg0817313550 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17313550
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTATTCTTCGATTGTTTTTTCGAAGTTGATAAAGATGTGTTTTACTTCCTTTTCGCTATTCTTTGCATTGTCACTTTTCGTGCTTTCGTTAGGTCGGAAC[G/A]
TGTTGGCCCATTTGCGTATATTAGCGAAATAGGTCTGCTGACTTTTCAGCTTTCGGCTTCCGTTTTCGATCTGTAGTATTCTGCGCTGATAGGAGCGCTT

Reverse complement sequence

AAGCGCTCCTATCAGCGCAGAATACTACAGATCGAAAACGGAAGCCGAAAGCTGAAAAGTCAGCAGACCTATTTCGCTAATATACGCAAATGGGCCAACA[C/T]
GTTCCGACCTAACGAAAGCACGAAAAGTGACAATGCAAAGAATAGCGAAAAGGAAGTAAAACACATCTTTATCAACTTCGAAAAAACAATCGAAGAATAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	16.20%	2.16%	5.21%	NA
All Indica	2759	66.00%	24.80%	1.92%	7.29%	NA
All Japonica	1512	99.20%	0.30%	0.13%	0.40%	NA
Aus	269	45.00%	24.90%	16.73%	13.38%	NA
Indica I	595	57.30%	37.80%	0.67%	4.20%	NA
Indica II	465	90.50%	8.60%	0.00%	0.86%	NA
Indica III	913	65.10%	20.20%	3.72%	11.06%	NA
Indica Intermediate	786	59.30%	29.80%	1.91%	9.03%	NA
Temperate Japonica	767	99.50%	0.30%	0.00%	0.26%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	13.30%	2.22%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817313550	G -> A	LOC_Os08g28370.1	downstream_gene_variant ; 4530.0bp to feature; MODIFIER	silent_mutation	Average:43.561; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0817313550	G -> A	LOC_Os08g28380.1	downstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:43.561; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0817313550	G -> A	LOC_Os08g28390.1	downstream_gene_variant ; 349.0bp to feature; MODIFIER	silent_mutation	Average:43.561; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0817313550	G -> A	LOC_Os08g28380-LOC_Os08g28390	intergenic_region ; MODIFIER	silent_mutation	Average:43.561; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0817313550	G -> DEL	N	N	silent_mutation	Average:43.561; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817313550	1.50E-06	NA	mr1348	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817313550	1.95E-06	1.95E-06	mr1348	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0817313550:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact