Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817221859:

Variant ID: vg0817221859 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17221859
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTACTCTACATAGTTTCTTATTTCAGCTCACTCACAATATAATTATTTCTACTACAGAGAGTTACTCCCCCCTTTTCATAATGTAAGTCATTTTAGCATT[A/G]
CCCATATTCATATAGATGTTAATGAATCTAGATATAGTTGTAAATTAAAGTTACTTTTCTTTTGTTATAAGTTACTTCTATAATATATTTCTATAATATA

Reverse complement sequence

TATATTATAGAAATATATTATAGAAGTAACTTATAACAAAAGAAAAGTAACTTTAATTTACAACTATATCTAGATTCATTAACATCTATATGAATATGGG[T/C]
AATGCTAAAATGACTTACATTATGAAAAGGGGGGAGTAACTCTCTGTAGTAGAAATAATTATATTGTGAGTGAGCTGAAATAAGAAACTATGTAGAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.30%	15.50%	5.92%	4.23%	NA
All Indica	2759	86.70%	1.60%	7.61%	4.10%	NA
All Japonica	1512	47.10%	44.00%	3.51%	5.42%	NA
Aus	269	93.70%	3.00%	3.35%	0.00%	NA
Indica I	595	92.40%	1.70%	4.37%	1.51%	NA
Indica II	465	59.10%	2.40%	24.52%	13.98%	NA
Indica III	913	96.50%	0.50%	0.88%	2.08%	NA
Indica Intermediate	786	87.30%	2.30%	7.89%	2.54%	NA
Temperate Japonica	767	30.40%	64.70%	4.82%	0.13%	NA
Tropical Japonica	504	64.90%	17.70%	2.18%	15.28%	NA
Japonica Intermediate	241	63.10%	33.20%	2.07%	1.66%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	17.80%	8.89%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817221859	A -> G	LOC_Os08g28214.1	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28230.1	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28214.2	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28214.3	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28214.6	upstream_gene_variant ; 610.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28214.4	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28214.5	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> G	LOC_Os08g28214-LOC_Os08g28230	intergenic_region ; MODIFIER	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0817221859	A -> DEL	N	N	silent_mutation	Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817221859	3.93E-06	3.80E-15	mr1401	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817221859	NA	1.45E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817221859	NA	2.87E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251