Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817173341:

Variant ID: vg0817173341 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17173341
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TAACTTTGAAAGATTATGGTCTTACTTTTGAGAAAGTGCCTCTCTTTTGTGATAATACTACTGCTATAAACATTGCTAAGAATCCTGTACAAAGCATATT[G/A]
ATATTCGCTTTCACTTTTTGAGGGATCATGTTGAGAAGGGTGATGTTGAATTGACGTTTTTGGATACAAAGTTGTAACTTGCTGATATTTTCACTAAACC

Reverse complement sequence

GGTTTAGTGAAAATATCAGCAAGTTACAACTTTGTATCCAAAAACGTCAATTCAACATCACCCTTCTCAACATGATCCCTCAAAAAGTGAAAGCGAATAT[C/T]
AATATGCTTTGTACAGGATTCTTAGCAATGTTTATAGCAGTAGTATTATCACAAAAGAGAGGCACTTTCTCAAAAGTAAGACCATAATCTTTCAAAGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.40%	6.00%	0.61%	0.00%	NA
All Indica	2759	99.10%	0.80%	0.07%	0.00%	NA
All Japonica	1512	81.40%	16.90%	1.72%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.00%	0.13%	0.00%	NA
Temperate Japonica	767	94.90%	2.30%	2.74%	0.00%	NA
Tropical Japonica	504	58.50%	41.30%	0.20%	0.00%	NA
Japonica Intermediate	241	86.30%	12.00%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817173341	G -> A	LOC_Os08g28130.1	downstream_gene_variant ; 3854.0bp to feature; MODIFIER	silent_mutation	Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0817173341	G -> A	LOC_Os08g28140.1	downstream_gene_variant ; 70.0bp to feature; MODIFIER	silent_mutation	Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0817173341	G -> A	LOC_Os08g28140-LOC_Os08g28150	intergenic_region ; MODIFIER	silent_mutation	Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817173341	3.09E-08	2.65E-20	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	2.61E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	1.16E-08	2.11E-20	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	2.83E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	1.21E-08	6.50E-22	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	5.56E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	3.02E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	7.56E-08	5.23E-21	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	6.42E-13	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	2.18E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	3.37E-08	2.91E-15	mr1993_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341	NA	1.45E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251