Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817097760:

Variant ID: vg0817097760 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17097760
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGAGCTTTTCTACGCGAACGACGGCGAGTTCGTACCCACGTCGTCTCCCGGCCAGATGCGTGCGGACGGTGCGAAGTAGCAACACGAGGGTGATCTCT[G/A]
GCGAGCTTGCTCGTGCCTTCCCCGAGATCGACCGCACCGGACGGACGGGCGATGGCGCGATTGACGCGGACGCGAGCGGTGGCGGATTGACGACGGCGGC

Reverse complement sequence

GCCGCCGTCGTCAATCCGCCACCGCTCGCGTCCGCGTCAATCGCGCCATCGCCCGTCCGTCCGGTGCGGTCGATCTCGGGGAAGGCACGAGCAAGCTCGC[C/T]
AGAGATCACCCTCGTGTTGCTACTTCGCACCGTCCGCACGCATCTGGCCGGGAGACGACGTGGGTACGAACTCGCCGTCGTTCGCGTAGAAAAGCTCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	15.90%	0.21%	4.72%	NA
All Indica	2759	91.10%	1.00%	0.11%	7.83%	NA
All Japonica	1512	58.30%	41.10%	0.20%	0.46%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.60%	0.20%	0.00%	4.20%	NA
Indica II	465	96.80%	2.80%	0.00%	0.43%	NA
Indica III	913	87.40%	0.20%	0.22%	12.16%	NA
Indica Intermediate	786	88.50%	1.40%	0.13%	9.92%	NA
Temperate Japonica	767	69.80%	29.70%	0.26%	0.26%	NA
Tropical Japonica	504	48.80%	50.20%	0.00%	0.99%	NA
Japonica Intermediate	241	41.50%	58.10%	0.41%	0.00%	NA
VI/Aromatic	96	12.50%	85.40%	2.08%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817097760	G -> A	LOC_Os08g28050.1	upstream_gene_variant ; 309.0bp to feature; MODIFIER	silent_mutation	Average:63.015; most accessible tissue: Zhenshan97 young leaf, score: 88.637	N	N	N	N
vg0817097760	G -> A	LOC_Os08g28060.1	downstream_gene_variant ; 4719.0bp to feature; MODIFIER	silent_mutation	Average:63.015; most accessible tissue: Zhenshan97 young leaf, score: 88.637	N	N	N	N
vg0817097760	G -> A	LOC_Os08g28050-LOC_Os08g28060	intergenic_region ; MODIFIER	silent_mutation	Average:63.015; most accessible tissue: Zhenshan97 young leaf, score: 88.637	N	N	N	N
vg0817097760	G -> DEL	N	N	silent_mutation	Average:63.015; most accessible tissue: Zhenshan97 young leaf, score: 88.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817097760	1.01E-06	NA	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817097760	4.91E-07	NA	mr1006	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817097760	1.20E-06	NA	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817097760	4.72E-06	NA	mr1007	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817097760	1.17E-06	NA	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817097760	5.73E-07	NA	mr1052	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817097760	4.51E-06	NA	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251