Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817018173:

Variant ID: vg0817018173 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17018173
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGAGGTTGACGCCGAAGATATGAATCGTGAGAAGTTCTGGATCTGAAGCCCCATCATCAAGTGCCACAACCCAGTCGAAGTCGGCTAAAGGTTCAACC[G/A]
GAGATAAGTCAGGTGAAGAGAAGATTCCAGCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTGTTATAAAAGACG

Reverse complement sequence

CGTCTTTTATAACAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGCTGGAATCTTCTCTTCACCTGACTTATCTC[C/T]
GGTTGAACCTTTAGCCGACTTCGACTGGGTTGTGGCACTTGATGATGGGGCTTCAGATCCAGAACTTCTCACGATTCATATCTTCGGCGTCAACCTCACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	9.40%	13.65%	29.64%	NA
All Indica	2759	19.90%	13.30%	19.79%	47.05%	NA
All Japonica	1512	93.10%	2.20%	4.03%	0.66%	NA
Aus	269	58.70%	0.40%	8.55%	32.34%	NA
Indica I	595	12.80%	2.00%	9.24%	75.97%	NA
Indica II	465	14.40%	23.00%	21.94%	40.65%	NA
Indica III	913	21.20%	22.00%	25.41%	31.33%	NA
Indica Intermediate	786	27.00%	5.90%	19.97%	47.20%	NA
Temperate Japonica	767	94.30%	1.40%	3.39%	0.91%	NA
Tropical Japonica	504	95.00%	1.80%	2.98%	0.20%	NA
Japonica Intermediate	241	85.50%	5.40%	8.30%	0.83%	NA
VI/Aromatic	96	54.20%	41.70%	4.17%	0.00%	NA
Intermediate	90	74.40%	6.70%	12.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817018173	G -> A	LOC_Os08g27920.1	upstream_gene_variant ; 2403.0bp to feature; MODIFIER	silent_mutation	Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0817018173	G -> A	LOC_Os08g27910.1	downstream_gene_variant ; 2147.0bp to feature; MODIFIER	silent_mutation	Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0817018173	G -> A	LOC_Os08g27910-LOC_Os08g27920	intergenic_region ; MODIFIER	silent_mutation	Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0817018173	G -> DEL	N	N	silent_mutation	Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817018173	NA	1.17E-06	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173	8.81E-07	NA	mr1039_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173	1.08E-07	1.08E-07	mr1389_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173	1.50E-06	NA	mr1632_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173	NA	2.78E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173	NA	1.82E-06	mr1968_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251