Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816544331:

Variant ID: vg0816544331 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16544331
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTGTCCCGTCGGCACGCTGCTAGGGGCGCCCCACGCGCGTGATGAACCGCCGAAGTCTTCATGCAATTAATAGGGAATGACAGGGATGTCCCCCGTGT[C/T]
AGGCAGAGGACAGCGCTGGGCCCCACCTGAAGATAGGCGACCATGTTGCTTCCGGTTGAAGCAAAGGATAGCGGTATGATTAGGACCATGTGGGTCCCCC

Reverse complement sequence

GGGGGACCCACATGGTCCTAATCATACCGCTATCCTTTGCTTCAACCGGAAGCAACATGGTCGCCTATCTTCAGGTGGGGCCCAGCGCTGTCCTCTGCCT[G/A]
ACACGGGGGACATCCCTGTCATTCCCTATTAATTGCATGAAGACTTCGGCGGTTCATCACGCGCGTGGGGCGCCCCTAGCAGCGTGCCGACGGGACAGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.50% 0.00% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 91.90% 8.10% 0.00% 0.00% NA
Aus  269 73.60% 26.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.20% 0.00% 0.00% NA
Temperate Japonica  767 95.30% 4.70% 0.00% 0.00% NA
Tropical Japonica  504 84.50% 15.50% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816544331 C -> T LOC_Os08g27070.1 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:76.414; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0816544331 C -> T LOC_Os08g27080.1 upstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:76.414; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0816544331 C -> T LOC_Os08g27090.1 downstream_gene_variant ; 2106.0bp to feature; MODIFIER silent_mutation Average:76.414; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0816544331 C -> T LOC_Os08g27070-LOC_Os08g27080 intergenic_region ; MODIFIER silent_mutation Average:76.414; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0816544331 C T 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816544331 3.42E-06 NA mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 1.33E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 2.25E-07 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 3.03E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 4.65E-06 4.65E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 6.28E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 5.19E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 2.27E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 4.79E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 6.48E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 7.60E-06 7.59E-06 mr1372_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 3.83E-08 NA mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 7.84E-06 4.04E-08 mr1403_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 5.10E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 7.19E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 2.35E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 3.20E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816544331 NA 2.58E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251