Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816234557:

Variant ID: vg0816234557 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16234557
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGAGTGGTCCCAAAGCACTTTTTGACACAATTTGCTACTATGGACTAGCAAATACCAAATGCCAAATTGCCAACTTTTGCTACTAGTGTTTAGATCCA[A/G]
AATAGCAAAAAGTGCTACAAAATGGCAAAACTTTTGCCATTTTGGAGGATCTAAACAGGGCCTTACGTAGAGAGAAACGGAAAAGAGAAATAATGGTAAC

Reverse complement sequence

GTTACCATTATTTCTCTTTTCCGTTTCTCTCTACGTAAGGCCCTGTTTAGATCCTCCAAAATGGCAAAAGTTTTGCCATTTTGTAGCACTTTTTGCTATT[T/C]
TGGATCTAAACACTAGTAGCAAAAGTTGGCAATTTGGCATTTGGTATTTGCTAGTCCATAGTAGCAAATTGTGTCAAAAAGTGCTTTGGGACCACTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.70%	0.90%	0.72%	57.74%	NA
All Indica	2759	22.00%	1.40%	1.09%	75.50%	NA
All Japonica	1512	74.30%	0.00%	0.20%	25.46%	NA
Aus	269	17.50%	0.00%	0.37%	82.16%	NA
Indica I	595	46.70%	2.20%	0.84%	50.25%	NA
Indica II	465	23.70%	1.70%	1.72%	72.90%	NA
Indica III	913	3.70%	0.00%	0.22%	96.06%	NA
Indica Intermediate	786	23.50%	2.30%	1.91%	72.26%	NA
Temperate Japonica	767	98.70%	0.00%	0.00%	1.30%	NA
Tropical Japonica	504	36.70%	0.00%	0.40%	62.90%	NA
Japonica Intermediate	241	75.50%	0.00%	0.41%	24.07%	NA
VI/Aromatic	96	91.70%	1.00%	0.00%	7.29%	NA
Intermediate	90	62.20%	1.10%	0.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816234557	A -> G	LOC_Os08g26690.1	downstream_gene_variant ; 1611.0bp to feature; MODIFIER	silent_mutation	Average:15.111; most accessible tissue: Callus, score: 32.265	N	N	N	N
vg0816234557	A -> G	LOC_Os08g26700.1	downstream_gene_variant ; 4026.0bp to feature; MODIFIER	silent_mutation	Average:15.111; most accessible tissue: Callus, score: 32.265	N	N	N	N
vg0816234557	A -> G	LOC_Os08g26700.2	downstream_gene_variant ; 2905.0bp to feature; MODIFIER	silent_mutation	Average:15.111; most accessible tissue: Callus, score: 32.265	N	N	N	N
vg0816234557	A -> G	LOC_Os08g26700.3	downstream_gene_variant ; 2905.0bp to feature; MODIFIER	silent_mutation	Average:15.111; most accessible tissue: Callus, score: 32.265	N	N	N	N
vg0816234557	A -> G	LOC_Os08g26690-LOC_Os08g26700	intergenic_region ; MODIFIER	silent_mutation	Average:15.111; most accessible tissue: Callus, score: 32.265	N	N	N	N
vg0816234557	A -> DEL	N	N	silent_mutation	Average:15.111; most accessible tissue: Callus, score: 32.265	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816234557	NA	1.68E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816234557	NA	3.90E-16	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816234557	9.25E-06	NA	mr1134_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816234557	4.33E-07	8.21E-06	mr1134_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251