Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816111876:

Variant ID: vg0816111876 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16111876
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACTTTATTTTCCTAAGGGTTATAATTTGATTAGCTAGAACCTTATATATTAGTTTGGTTCAGCTAAATGCTATATATATAATTGCTTAGCCATGCTTAG[G/A]
AACATTAGCTCACTAATAGGATGAATCATATATACTACATTATTATTTATGGTTATATTTAATGGTAGCTTACGATGGTTAATCATGTTATGATAATTAA

Reverse complement sequence

TTAATTATCATAACATGATTAACCATCGTAAGCTACCATTAAATATAACCATAAATAATAATGTAGTATATATGATTCATCCTATTAGTGAGCTAATGTT[C/T]
CTAAGCATGGCTAAGCAATTATATATATAGCATTTAGCTGAACCAAACTAATATATAAGGTTCTAGCTAATCAAATTATAACCCTTAGGAAAATAAAGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.20%	1.10%	45.87%	26.83%	NA
All Indica	2759	8.80%	0.10%	65.17%	25.95%	NA
All Japonica	1512	55.60%	3.10%	10.45%	30.89%	NA
Aus	269	8.90%	0.00%	67.66%	23.42%	NA
Indica I	595	20.80%	0.00%	45.04%	34.12%	NA
Indica II	465	8.20%	0.00%	55.91%	35.91%	NA
Indica III	913	2.00%	0.00%	86.20%	11.83%	NA
Indica Intermediate	786	7.90%	0.40%	61.45%	30.28%	NA
Temperate Japonica	767	90.10%	6.10%	0.78%	3.00%	NA
Tropical Japonica	504	10.70%	0.00%	26.79%	62.50%	NA
Japonica Intermediate	241	39.40%	0.00%	7.05%	53.53%	NA
VI/Aromatic	96	92.70%	0.00%	5.21%	2.08%	NA
Intermediate	90	50.00%	0.00%	27.78%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816111876	G -> A	LOC_Os08g26440.1	upstream_gene_variant ; 556.0bp to feature; MODIFIER	silent_mutation	Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0816111876	G -> A	LOC_Os08g26450.1	upstream_gene_variant ; 2201.0bp to feature; MODIFIER	silent_mutation	Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0816111876	G -> A	LOC_Os08g26430.1	downstream_gene_variant ; 3292.0bp to feature; MODIFIER	silent_mutation	Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0816111876	G -> A	LOC_Os08g26440-LOC_Os08g26450	intergenic_region ; MODIFIER	silent_mutation	Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0816111876	G -> DEL	N	N	silent_mutation	Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816111876	1.09E-06	NA	mr1335_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251