Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815704890:

Variant ID: vg0815704890 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15704890
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTTGTGATTCATTGGATCTGGATCTGTGTTATTTGATCTGTGATGTATTTGTGATCTGTGATGTATATGTGACTGTGATTGTGATGTAATTTTTTTTA[A/G]
AATTTGTGATGTTTTTTTCTGACAATTTGTGATGTGAATATTATGATTTGTGATGTTGCTATGTGATCTGGGGATGTAGGGAGCATCTCAATTTCGATTT

Reverse complement sequence

AAATCGAAATTGAGATGCTCCCTACATCCCCAGATCACATAGCAACATCACAAATCATAATATTCACATCACAAATTGTCAGAAAAAAACATCACAAATT[T/C]
TAAAAAAAATTACATCACAATCACAGTCACATATACATCACAGATCACAAATACATCACAGATCAAATAACACAGATCCAGATCCAATGAATCACAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.30%	18.10%	20.95%	41.60%	NA
All Indica	2759	0.70%	8.60%	23.99%	66.80%	NA
All Japonica	1512	57.90%	27.20%	13.49%	1.32%	NA
Aus	269	0.40%	32.00%	37.55%	30.11%	NA
Indica I	595	0.00%	3.70%	11.76%	84.54%	NA
Indica II	465	0.60%	5.20%	21.72%	72.47%	NA
Indica III	913	0.20%	12.30%	32.97%	54.55%	NA
Indica Intermediate	786	1.70%	9.90%	24.17%	64.25%	NA
Temperate Japonica	767	95.40%	1.40%	1.96%	1.17%	NA
Tropical Japonica	504	11.10%	66.90%	21.23%	0.79%	NA
Japonica Intermediate	241	36.50%	26.60%	34.02%	2.90%	NA
VI/Aromatic	96	1.00%	95.80%	3.12%	0.00%	NA
Intermediate	90	20.00%	33.30%	22.22%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815704890	A -> G	LOC_Os08g25799.1	downstream_gene_variant ; 930.0bp to feature; MODIFIER	silent_mutation	Average:66.972; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0815704890	A -> G	LOC_Os08g25799-LOC_Os08g25820	intergenic_region ; MODIFIER	silent_mutation	Average:66.972; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0815704890	A -> DEL	N	N	silent_mutation	Average:66.972; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815704890	NA	4.08E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	2.54E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	1.51E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	3.94E-13	mr1454	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	6.34E-37	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	6.14E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	1.02E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	8.03E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	2.68E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	3.65E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	8.24E-10	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	2.02E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	4.54E-08	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	4.72E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815704890	NA	8.44E-17	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251