Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815685490:

Variant ID: vg0815685490 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15685490
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATAGGACGGCCCGGAGGGGAATATTCCTCGCAGATGCCGGTTGGGGGATCCGGCCGAATCGGCCGGATGTGGCCGCATGACCGATGGGCGCGCGGGTC[A/G]
AGCGGTCGCGTCACCTCCATCCATGGAGAGAGAAGGGACCATATCCTATCCAACCTTAACCGTGAACCAAACGCACCCTTGTTGTCAGGCTTTGCCCAAC

Reverse complement sequence

GTTGGGCAAAGCCTGACAACAAGGGTGCGTTTGGTTCACGGTTAAGGTTGGATAGGATATGGTCCCTTCTCTCTCCATGGATGGAGGTGACGCGACCGCT[T/C]
GACCCGCGCGCCCATCGGTCATGCGGCCACATCCGGCCGATTCGGCCGGATCCCCCAACCGGCATCTGCGAGGAATATTCCCCTCCGGGCCGTCCTATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 19.70% 0.00% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 42.50% 57.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 8.60% 91.40% 0.00% 0.00% NA
Tropical Japonica  504 87.90% 12.10% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815685490 A -> G LOC_Os08g25760.1 upstream_gene_variant ; 2385.0bp to feature; MODIFIER silent_mutation Average:79.002; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0815685490 A -> G LOC_Os08g25770.1 upstream_gene_variant ; 1922.0bp to feature; MODIFIER silent_mutation Average:79.002; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0815685490 A -> G LOC_Os08g25780.1 upstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:79.002; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0815685490 A -> G LOC_Os08g25760-LOC_Os08g25770 intergenic_region ; MODIFIER silent_mutation Average:79.002; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815685490 A G -0.02 0.0 0.0 0.0 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815685490 NA 1.43E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 7.00E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 8.08E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 8.32E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 3.83E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 1.62E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 3.98E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 6.75E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 1.01E-09 mr1599 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 1.17E-22 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 3.50E-06 mr1689 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815685490 NA 3.43E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251