Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815510507:

Variant ID: vg0815510507 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15510507
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGTTTCAACTTTCAACTTTATATTTGTAACGGTGGAATGCTCTGCGCATTGCTGAAGACGTTGGAACGATCGATGAGCGTCTTGGCCCCGACGAGCCG[T/G]
TCGAAGTTCGCCGGCGAGAAGTACGCCGAGCCCCACGTCGACCGTGCTCGGCTCACCGACGACGACGGCGAGGACACGTTCCCGGCGAGAGCATTGGTGC

Reverse complement sequence

GCACCAATGCTCTCGCCGGGAACGTGTCCTCGCCGTCGTCGTCGGTGAGCCGAGCACGGTCGACGTGGGGCTCGGCGTACTTCTCGCCGGCGAACTTCGA[A/C]
CGGCTCGTCGGGGCCAAGACGCTCATCGATCGTTCCAACGTCTTCAGCAATGCGCAGAGCATTCCACCGTTACAAATATAAAGTTGAAAGTTGAAACAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 21.20% 0.00% 1.35% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 31.80% 64.00% 0.00% 4.23% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 6.10% 85.90% 0.00% 7.95% NA
Tropical Japonica  504 72.20% 27.80% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 69.70% 0.00% 1.24% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815510507 T -> G LOC_Os08g25490.1 missense_variant ; p.Glu491Asp; MODERATE nonsynonymous_codon ; E491D Average:78.255; most accessible tissue: Zhenshan97 young leaf, score: 86.852 unknown unknown TOLERATED 1.00
vg0815510507 T -> DEL LOC_Os08g25490.1 N frameshift_variant Average:78.255; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815510507 T G 0.05 0.02 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815510507 NA 3.97E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 3.36E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 5.28E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 3.71E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 5.30E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 3.14E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 1.11E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 7.11E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 2.15E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 1.33E-36 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 9.87E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 7.58E-27 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 1.09E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 1.96E-07 NA mr1672_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815510507 NA 2.83E-07 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251