| Variant ID: vg0815185480 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15185480 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCGCGTCGATGTAGAGTAAGTAGTCGATCGCACCGGCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCACGCCGATCAGCACCGCAAAC[C/T]
AGCGGCGCCTCTACCGGTATCCACACGTACAGGAACGGAACGCCACGCGCAGATGTGCTAGCACTCACGCACGGCTAGGGTTTTGCTCGGGGAGGCAAGT
ACTTGCCTCCCCGAGCAAAACCCTAGCCGTGCGTGAGTGCTAGCACATCTGCGCGTGGCGTTCCGTTCCTGTACGTGTGGATACCGGTAGAGGCGCCGCT[G/A]
GTTTGCGGTGCTGATCGGCGTGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGCCGGTGCGATCGACTACTTACTCTACATCGACGCGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.80% | 18.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.40% | 46.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815185480 | C -> T | LOC_Os08g25020.1 | downstream_gene_variant ; 3784.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0815185480 | C -> T | LOC_Os08g25010-LOC_Os08g25020 | intergenic_region ; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815185480 | NA | 4.11E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815185480 | 4.92E-06 | NA | mr1363_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815185480 | NA | 7.18E-08 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815185480 | NA | 1.86E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |